Rmu_sc0000792.1_g000021

Heavy-metal-associated domain

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000792.1
Physical Location & Seq
Forward (+)
110874 .. 111510
637 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000792.1_g000021.1.cds

Sequence Viewer

Length: 405 bp
atggggaagcttagttttggaagggtgctaggctctctttgtctttcttctggatcaagttcttgtttctgcatgaactactccgaggaaaaccaagacgagtttgagaaaagtccattgattcctggtgaaaaggatcagcttatgagactcaaggatgttgttgccggtaaacaaacattggcatttcaactgaaacccaagatggtaatgttaagggtctccatgcactgcaatggatgtgccaggaaagttgaaaaacatatctcgaagatggaaggggtgacttcgtacaaagtagacctggaaagcaagatggtggttgtgatcggagatgttctgccttatgaggtggtgcagagtgtgtctaaggtaaaaaatgccgagatttggaactcgccgtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

134

Amino Acids

14.89

Weight (kDa)

8.59

Isoelectric Point (pI)

47.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013076)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 300
AclWI GGATC 2 cut(s) 61, 144
AfaI GTAC 1 cut(s) 293
AfiI CCNNNNNNNGG 1 cut(s) 390
AgsI TTSAA 2 cut(s) 191, 257
AjnI CCWGG 3 cut(s) 124, 245, 303
AluBI AGCT 2 cut(s) 10, 142
AluI AGCT 2 cut(s) 10, 142
Alw26I GTCTC 2 cut(s) 142, 226
AlwI GGATC 2 cut(s) 61, 144
AsuHPI GGTGA 2 cut(s) 140, 295
BccI CCATC 3 cut(s) 199, 268, 310
BceAI ACGGC 1 cut(s) 385
BciT130I CCWGG 3 cut(s) 126, 247, 305
BcoDI GTCTC 2 cut(s) 142, 226
BfaI CTAG 1 cut(s) 29
Bme1390I CCNGG 3 cut(s) 126, 247, 305
BmrFI CCNGG 3 cut(s) 126, 247, 305
BpuEI CTTGAG 1 cut(s) 137
BsaI GGTCTC 1 cut(s) 226
BsaJI CCNNGG 1 cut(s) 84
Bsc4I CCNNNNNNNGG 1 cut(s) 390
Bse118I RCCGGY 1 cut(s) 167
Bse3DI GCAATG 1 cut(s) 241
BseBI CCWGG 3 cut(s) 126, 247, 305
BseDI CCNNGG 1 cut(s) 84
BseGI GGATG 2 cut(s) 163, 245
BseLI CCNNNNNNNGG 1 cut(s) 390
BseMI GCAATG 1 cut(s) 241
BsgI GTGCAG 1 cut(s) 377
BsiSI CCGG 1 cut(s) 168
BslI CCNNNNNNNGG 1 cut(s) 390
BsmAI GTCTC 2 cut(s) 142, 226
Bso31I GGTCTC 1 cut(s) 226
Bsp143I GATC 3 cut(s) 53, 136, 327
BspPI GGATC 2 cut(s) 61, 144
BspTNI GGTCTC 1 cut(s) 226
BsrDI GCAATG 1 cut(s) 241
BsrFI RCCGGY 1 cut(s) 167
BssAI RCCGGY 1 cut(s) 167
BssECI CCNNGG 1 cut(s) 84
BssMI GATC 3 cut(s) 53, 136, 327
Bst2UI CCWGG 3 cut(s) 126, 247, 305
BstDEI CTNAG 2 cut(s) 11, 369
BstF5I GGATG 2 cut(s) 163, 245
BstKTI GATC 3 cut(s) 56, 139, 330
BstMAI GTCTC 2 cut(s) 142, 226
BstMBI GATC 3 cut(s) 53, 136, 327
BstNI CCWGG 3 cut(s) 126, 247, 305
BstSCI CCNGG 3 cut(s) 124, 245, 303
BtsCI GGATG 2 cut(s) 163, 245
BtsI GCAGTG 1 cut(s) 229
BtsIMutI CAGTG 1 cut(s) 229
Cfr10I RCCGGY 1 cut(s) 167
Csp6I GTAC 1 cut(s) 292
CviAII CATG 2 cut(s) 73, 226
CviJI RGCY 3 cut(s) 10, 33, 142
CviKI_1 RGCY 3 cut(s) 10, 33, 142
CviQI GTAC 1 cut(s) 292
DdeI CTNAG 2 cut(s) 11, 369
DpnI GATC 3 cut(s) 55, 138, 329
DpnII GATC 3 cut(s) 53, 136, 327
Eco31I GGTCTC 1 cut(s) 226
EcoRII CCWGG 3 cut(s) 124, 245, 303
FaeI CATG 2 cut(s) 76, 229
FaiI YATR 5 cut(s) 74, 146, 227, 264, 348
FatI CATG 2 cut(s) 72, 225
FblI GTMKAC 1 cut(s) 300
FokI GGATG 2 cut(s) 170, 252
FspBI CTAG 1 cut(s) 29
HapII CCGG 1 cut(s) 168
Hin1II CATG 2 cut(s) 76, 229
HindIII AAGCTT 1 cut(s) 8
HinfI GANTC 2 cut(s) 121, 150
HpaII CCGG 1 cut(s) 168
HphI GGTGA 2 cut(s) 140, 295
Hpy166II GTNNAC 2 cut(s) 173, 301
Hpy188I TCNGA 2 cut(s) 85, 332
Hpy188III TCNNGA 2 cut(s) 51, 268
Hpy8I GTNNAC 2 cut(s) 173, 301
HpyAV CCTTC 2 cut(s) 15, 272
HpyCH4V TGCA 4 cut(s) 72, 229, 234, 358
HpyF3I CTNAG 2 cut(s) 11, 369
Hsp92II CATG 2 cut(s) 76, 229
Kzo9I GATC 3 cut(s) 53, 136, 327
LpnPI CCDG 8 cut(s) 36, 111, 138, 181, 232, 259, 290, 317
MaeI CTAG 1 cut(s) 29
MaeIII GTNAC 1 cut(s) 283
MalI GATC 3 cut(s) 55, 138, 329
MboI GATC 3 cut(s) 53, 136, 327
MboII GAAGA 2 cut(s) 39, 283
MlyI GAGTC 1 cut(s) 144
MnlI CCTC 2 cut(s) 79, 343
MseI TTAA 1 cut(s) 215
MslI CAYNNNNRTG 1 cut(s) 234
MspI CCGG 1 cut(s) 168
MspR9I CCNGG 3 cut(s) 126, 247, 305
MvaI CCWGG 3 cut(s) 126, 247, 305
NdeII GATC 3 cut(s) 53, 136, 327
NlaIII CATG 2 cut(s) 76, 229
NmuCI GTSAC 1 cut(s) 283
PfeI GAWTC 1 cut(s) 121
PleI GAGTC 1 cut(s) 144
PpsI GAGTC 1 cut(s) 144
Psp6I CCWGG 3 cut(s) 124, 245, 303
PspGI CCWGG 3 cut(s) 124, 245, 303
RsaI GTAC 1 cut(s) 293
RsaNI GTAC 1 cut(s) 292
RseI CAYNNNNRTG 1 cut(s) 234
SaqAI TTAA 1 cut(s) 215
Sau3AI GATC 3 cut(s) 53, 136, 327
SchI GAGTC 1 cut(s) 144
ScrFI CCNGG 3 cut(s) 126, 247, 305
SetI ASST 5 cut(s) 12, 144, 306, 354, 375
SmiMI CAYNNNNRTG 1 cut(s) 234
SmlI CTYRAG 1 cut(s) 152
SmoI CTYRAG 1 cut(s) 152
SspMI CTAG 1 cut(s) 29
StyD4I CCNGG 3 cut(s) 124, 245, 303
TaqI TCGA 1 cut(s) 269
TfiI GAWTC 1 cut(s) 121
Tru1I TTAA 1 cut(s) 215
Tru9I TTAA 1 cut(s) 215
TscAI CASTG 1 cut(s) 236
TseFI GTSAC 1 cut(s) 283
Tsp45I GTSAC 1 cut(s) 283
TspDTI ATGAA 1 cut(s) 89
TspRI CASTG 1 cut(s) 236
XmiI GTMKAC 1 cut(s) 300
XspI CTAG 1 cut(s) 29
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.