Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000795.1

Orthogroup ID

OG0018802

Physical Location & Seq

Genomic Coordinates Forward (+)

278243 .. 278563

Gene Structure 321 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000795.1_g000055.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 321 bp

atgctggacacatccaactccagcacgcatttgaactctgttgttttgatcacagattgggcgtggatatataagaactcccggagtgtggagaaggttcttgatgagtcattaagggaggaaggaccaaaggctgtgatggagaggcttgtaaatgttgggattcttagtgctcatgttatggtggcttttaggcctaccatttcagaagcactgaggatgttggagggtgatattgatattcaaaattaccagattggccaattccacttgggaatgagtcttatagatcttctgggttttctagcttcagtttggtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004672 GO:0004674 GO:0005575 GO:0005623 GO:0005886 GO:0006464 GO:0006468 GO:0006793 GO:0006796 GO:0006807 GO:0008150 GO:0008152 GO:0009987 GO:0016020 GO:0016301 GO:0016310 GO:0016740 GO:0016772 GO:0016773 GO:0019538 GO:0036211 GO:0043170 GO:0043412 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044464 GO:0071704 GO:0071944 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

ko04010 ko04064 ko04620 ko04621 ko04624 ko04722 ko05133 ko05140 ko05142 ko05145 ko05152 ko05162 ko05164 map04010 map04064 map04620 map04621 map04624 map04722 map05133 map05140 map05142 map05145 map05152 map05162 map05164

Pfam Domains

Protein Families

Pkinase Pkinase_Tyr

Protein Analysis

106

Amino Acids

11.93

Weight (kDa)

4.98

Isoelectric Point (pI)

29.06

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018802)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g27710
pyrus_communis	pycom08g07010
rosa_chinensis	RchiOBHm_Chr7g0203781
rosa_laevigata	RLG00000030041 RLG00000030745
rosa_multiflora	Rmu_sc0000795.1_g000055 Rmu_sc0001802.1_g000007 Rmu_sc0002194.1_g000020
rosa_samantha	Rh7BG294500

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcoI	YGGCCR	1 cut(s)	259
AcuI	CTGAAG	1 cut(s)	294
AfiI	CCNNNNNNNGG	1 cut(s)	88
AgsI	TTSAA	2 cut(s)	34, 245
AluBI	AGCT	1 cut(s)	308
AluI	AGCT	1 cut(s)	308
Alw21I	GWGCWC	1 cut(s)	175
AoxI	GGCC	2 cut(s)	194, 259
AspS9I	GGNCC	1 cut(s)	125
AsuC2I	CCSGG	1 cut(s)	82
AsuHPI	GGTGA	1 cut(s)	242
AvaII	GGWCC	1 cut(s)	125
BalI	TGGCCA	1 cut(s)	261
Bbv12I	GWGCWC	1 cut(s)	175
BccI	CCATC	1 cut(s)	133
BclI	TGATCA	1 cut(s)	48
BcnI	CCSGG	1 cut(s)	82
BfaI	CTAG	1 cut(s)	305
BglII	AGATCT	1 cut(s)	289
Bme1390I	CCNGG	1 cut(s)	82
Bme18I	GGWCC	1 cut(s)	125
BmgT120I	GGNCC	1 cut(s)	125
BmrFI	CCNGG	1 cut(s)	82
BpmI	CTGGAG	1 cut(s)	4
BpuMI	CCSGG	1 cut(s)	82
Bsc4I	CCNNNNNNNGG	1 cut(s)	88
BseGI	GGATG	2 cut(s)	11, 225
BseLI	CCNNNNNNNGG	1 cut(s)	88
BseMII	CTCAG	1 cut(s)	206
BshFI	GGCC	2 cut(s)	196, 261
BsiHKAI	GWGCWC	1 cut(s)	175
BsiSI	CCGG	1 cut(s)	82
BslI	CCNNNNNNNGG	1 cut(s)	88
BsnI	GGCC	2 cut(s)	196, 261
Bsp1286I	GDGCHC	1 cut(s)	175
Bsp143I	GATC	2 cut(s)	48, 289
BspANI	GGCC	2 cut(s)	196, 261
BspCNI	CTCAG	1 cut(s)	207
BssMI	GATC	2 cut(s)	48, 289
BstC8I	GCNNGC	1 cut(s)	26
BstDEI	CTNAG	2 cut(s)	167, 215
BstF5I	GGATG	2 cut(s)	11, 225
BstKTI	GATC	2 cut(s)	51, 292
BstMBI	GATC	2 cut(s)	48, 289
BstSCI	CCNGG	1 cut(s)	80
BstX2I	RGATCY	1 cut(s)	289
BstYI	RGATCY	1 cut(s)	289
BsuRI	GGCC	2 cut(s)	196, 261
BtsCI	GGATG	2 cut(s)	11, 225
BtsIMutI	CAGTG	1 cut(s)	212
Cac8I	GCNNGC	1 cut(s)	26
Cfr13I	GGNCC	1 cut(s)	125
CviAII	CATG	1 cut(s)	176
CviJI	RGCY	6 cut(s)	134, 148, 188, 196, 261, 308
CviKI_1	RGCY	6 cut(s)	134, 148, 188, 196, 261, 308
DdeI	CTNAG	2 cut(s)	167, 215
DpnI	GATC	2 cut(s)	50, 291
DpnII	GATC	2 cut(s)	48, 289
EaeI	YGGCCR	1 cut(s)	259
Eco147I	AGGCCT	1 cut(s)	196
Eco47I	GGWCC	1 cut(s)	125
Eco57I	CTGAAG	1 cut(s)	294
FaeI	CATG	1 cut(s)	179
FaiI	YATR	5 cut(s)	70, 72, 177, 182, 287
FatI	CATG	1 cut(s)	175
FbaI	TGATCA	1 cut(s)	48
FokI	GGATG	1 cut(s)	232
FspBI	CTAG	1 cut(s)	305
GsuI	CTGGAG	1 cut(s)	4
HaeIII	GGCC	2 cut(s)	196, 261
HapII	CCGG	1 cut(s)	82
Hin1II	CATG	1 cut(s)	179
HinfI	GANTC	3 cut(s)	107, 163, 280
HpaII	CCGG	1 cut(s)	82
HphI	GGTGA	1 cut(s)	242
Hpy188I	TCNGA	1 cut(s)	208
Hpy188III	TCNNGA	1 cut(s)	101
HpyAV	CCTTC	2 cut(s)	88, 116
HpyF3I	CTNAG	2 cut(s)	167, 215
Hsp92II	CATG	1 cut(s)	179
Ksp22I	TGATCA	1 cut(s)	48
Kzo9I	GATC	2 cut(s)	48, 289
LpnPI	CCDG	4 cut(s)	34, 95, 266, 281
MaeI	CTAG	1 cut(s)	305
MalI	GATC	2 cut(s)	50, 291
MboI	GATC	2 cut(s)	48, 289
MboII	GAAGA	1 cut(s)	284
MflI	RGATCY	1 cut(s)	289
MhlI	GDGCHC	1 cut(s)	175
MlsI	TGGCCA	1 cut(s)	261
MluCI	AATT	2 cut(s)	247, 263
MluNI	TGGCCA	1 cut(s)	261
MlyI	GAGTC	2 cut(s)	116, 289
MmeI	TCCRAC	2 cut(s)	39, 204
MnlI	CCTC	4 cut(s)	112, 138, 210, 220
Mox20I	TGGCCA	1 cut(s)	261
MscI	TGGCCA	1 cut(s)	261
MseI	TTAA	1 cut(s)	113
Msp20I	TGGCCA	1 cut(s)	261
MspI	CCGG	1 cut(s)	82
MspR9I	CCNGG	1 cut(s)	82
NciI	CCSGG	1 cut(s)	82
NdeII	GATC	2 cut(s)	48, 289
NlaIII	CATG	1 cut(s)	179
PceI	AGGCCT	1 cut(s)	196
PfeI	GAWTC	1 cut(s)	163
PfoI	TCCNGGA	1 cut(s)	80
PleI	GAGTC	2 cut(s)	115, 288
PpsI	GAGTC	2 cut(s)	115, 288
PspPI	GGNCC	1 cut(s)	125
PsuI	RGATCY	1 cut(s)	289
SaqAI	TTAA	1 cut(s)	113
Sau3AI	GATC	2 cut(s)	48, 289
Sau96I	GGNCC	1 cut(s)	125
SchI	GAGTC	2 cut(s)	116, 289
ScrFI	CCNGG	1 cut(s)	82
SduI	GDGCHC	1 cut(s)	175
SetI	ASST	2 cut(s)	99, 310
SinI	GGWCC	1 cut(s)	125
Sse9I	AATT	2 cut(s)	247, 263
SseBI	AGGCCT	1 cut(s)	196
SspMI	CTAG	1 cut(s)	305
StuI	AGGCCT	1 cut(s)	196
StyD4I	CCNGG	1 cut(s)	80
TasI	AATT	2 cut(s)	247, 263
TfiI	GAWTC	1 cut(s)	163
Tru1I	TTAA	1 cut(s)	113
Tru9I	TTAA	1 cut(s)	113
TscAI	CASTG	1 cut(s)	219
TspRI	CASTG	1 cut(s)	219
VpaK11BI	GGWCC	1 cut(s)	125
XspI	CTAG	1 cut(s)	305

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.