Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000809.1

Orthogroup ID

OG0016664

Physical Location & Seq

Genomic Coordinates Forward (+)

156695 .. 157089

Gene Structure 395 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000809.1_g000036.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 228 bp

atgggaaatgttgtggaattgaaggtgggcttgcactgtgaggaatgcatcaagaaaatcctgaaggccatcaagaagatcgaagatatcgaaacatataatgtggacacagagctgaacaaggtgattgtgactggtaatgtaaccacagaacaagtcatcagagctcttcagaagattaagaagaacgcagtcccttggggccaagaagacgaagcaacttcttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

HMA

Protein Analysis

75

Amino Acids

8.41

Weight (kDa)

5.79

Isoelectric Point (pI)

33.81

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016664)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G05365
fragaria_vesca	FvH4_7g25401 FvH4_7g25401
malus_domestica	MD01G1160400.v1.1
prunus_persica	Prupe.2G258300_v2.0.a1
rosa_chinensis	RchiOBHm_Chr1g0371361
rosa_multiflora	Rmu_sc0000809.1_g000036
rosa_roxburghii	Rroxscaffold_4G00285760
rosa_rugosa	Rorug01G0363300
rosa_samantha	Rh1AG373200 Rh1BG336700 Rh1CG350200 Rh1DG367800
rosa_wichuraiana	Rw1G032840

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcuI	CTGAAG	2 cut(s)	83, 155
AgsI	TTSAA	1 cut(s)	22
AluBI	AGCT	2 cut(s)	115, 167
AluI	AGCT	2 cut(s)	115, 167
Alw21I	GWGCWC	1 cut(s)	169
AoxI	GGCC	2 cut(s)	66, 202
AspS9I	GGNCC	1 cut(s)	202
AsuHPI	GGTGA	1 cut(s)	136
BanII	GRGCYC	1 cut(s)	169
BbsI	GAAGAC	1 cut(s)	216
Bbv12I	GWGCWC	1 cut(s)	169
BccI	CCATC	1 cut(s)	77
BmgT120I	GGNCC	1 cut(s)	202
BmiI	GGNNCC	1 cut(s)	203
BmsI	GCATC	1 cut(s)	57
BpiI	GAAGAC	1 cut(s)	216
BsaJI	CCNNGG	1 cut(s)	197
Bse1I	ACTGG	1 cut(s)	139
BseDI	CCNNGG	1 cut(s)	197
BseNI	ACTGG	1 cut(s)	139
BshFI	GGCC	2 cut(s)	68, 204
BsiHKAI	GWGCWC	1 cut(s)	169
BslFI	GGGAC	1 cut(s)	179
BsmFI	GGGAC	1 cut(s)	179
BsmI	GAATGC	1 cut(s)	50
BsnI	GGCC	2 cut(s)	68, 204
Bsp1286I	GDGCHC	1 cut(s)	169
Bsp143I	GATC	1 cut(s)	78
BspANI	GGCC	2 cut(s)	68, 204
BspLI	GGNNCC	1 cut(s)	203
BspQI	GCTCTTC	1 cut(s)	174
BsrI	ACTGG	1 cut(s)	139
BssECI	CCNNGG	1 cut(s)	197
BssMI	GATC	1 cut(s)	78
BssT1I	CCWWGG	1 cut(s)	197
Bst4CI	ACNGT	1 cut(s)	38
Bst6I	CTCTTC	1 cut(s)	174
BstC8I	GCNNGC	1 cut(s)	32
BstKTI	GATC	1 cut(s)	81
BstMBI	GATC	1 cut(s)	78
BstV2I	GAAGAC	1 cut(s)	216
BsuRI	GGCC	2 cut(s)	68, 204
BtsIMutI	CAGTG	1 cut(s)	34
Cac8I	GCNNGC	1 cut(s)	32
Cfr13I	GGNCC	1 cut(s)	202
CviJI	RGCY	5 cut(s)	30, 68, 115, 167, 204
CviKI_1	RGCY	5 cut(s)	30, 68, 115, 167, 204
DpnI	GATC	1 cut(s)	80
DpnII	GATC	1 cut(s)	78
Eam1104I	CTCTTC	1 cut(s)	174
EarI	CTCTTC	1 cut(s)	174
Ecl136II	GAGCTC	1 cut(s)	167
Eco130I	CCWWGG	1 cut(s)	197
Eco24I	GRGCYC	1 cut(s)	169
Eco32I	GATATC	1 cut(s)	88
Eco53kI	GAGCTC	1 cut(s)	167
Eco57I	CTGAAG	2 cut(s)	83, 155
EcoICRI	GAGCTC	1 cut(s)	167
EcoRV	GATATC	1 cut(s)	88
EcoT14I	CCWWGG	1 cut(s)	197
EcoT22I	ATGCAT	1 cut(s)	50
EcoT38I	GRGCYC	1 cut(s)	169
ErhI	CCWWGG	1 cut(s)	197
FaiI	YATR	2 cut(s)	97, 99
FalI	AAGNNNNNCTT	2 cut(s)	14, 46
FaqI	GGGAC	1 cut(s)	179
FriOI	GRGCYC	1 cut(s)	169
HaeIII	GGCC	2 cut(s)	68, 204
HphI	GGTGA	1 cut(s)	136
Hpy166II	GTNNAC	1 cut(s)	106
Hpy188I	TCNGA	2 cut(s)	164, 174
Hpy188III	TCNNGA	4 cut(s)	52, 61, 73, 225
Hpy8I	GTNNAC	1 cut(s)	106
HpyAV	CCTTC	2 cut(s)	16, 58
HpyCH4III	ACNGT	1 cut(s)	38
HpyCH4V	TGCA	2 cut(s)	34, 48
Kzo9I	GATC	1 cut(s)	78
LguI	GCTCTTC	1 cut(s)	174
LpnPI	CCDG	2 cut(s)	74, 120
LweI	GCATC	1 cut(s)	57
MaeIII	GTNAC	2 cut(s)	130, 142
MalI	GATC	1 cut(s)	80
MboI	GATC	1 cut(s)	78
MboII	GAAGA	6 cut(s)	88, 95, 161, 187, 196, 221
MhlI	GDGCHC	1 cut(s)	169
MluCI	AATT	1 cut(s)	17
MnlI	CCTC	1 cut(s)	34
Mph1103I	ATGCAT	1 cut(s)	50
MseI	TTAA	1 cut(s)	180
Mva1269I	GAATGC	1 cut(s)	50
NdeII	GATC	1 cut(s)	78
NlaIV	GGNNCC	1 cut(s)	203
NmuCI	GTSAC	1 cut(s)	130
NsiI	ATGCAT	1 cut(s)	50
PciSI	GCTCTTC	1 cut(s)	174
PcsI	WCGNNNNNNNCGW	1 cut(s)	87
PctI	GAATGC	1 cut(s)	50
Psp124BI	GAGCTC	1 cut(s)	169
PspN4I	GGNNCC	1 cut(s)	203
PspPI	GGNCC	1 cut(s)	202
SacI	GAGCTC	1 cut(s)	169
SapI	GCTCTTC	1 cut(s)	174
SaqAI	TTAA	1 cut(s)	180
Sau3AI	GATC	1 cut(s)	78
Sau96I	GGNCC	1 cut(s)	202
SduI	GDGCHC	1 cut(s)	169
SetI	ASST	4 cut(s)	27, 117, 126, 169
SfaNI	GCATC	1 cut(s)	57
SgeI	CNNG	9 cut(s)	43, 64, 73, 85, 133, 147, 167, 210, 218
Sse9I	AATT	1 cut(s)	17
SstI	GAGCTC	1 cut(s)	169
StyI	CCWWGG	1 cut(s)	197
TaaI	ACNGT	1 cut(s)	38
TaqI	TCGA	2 cut(s)	81, 90
TasI	AATT	1 cut(s)	17
Tru1I	TTAA	1 cut(s)	180
Tru9I	TTAA	1 cut(s)	180
TscAI	CASTG	1 cut(s)	41
TseFI	GTSAC	1 cut(s)	130
Tsp45I	GTSAC	1 cut(s)	130
TspRI	CASTG	1 cut(s)	41
Zsp2I	ATGCAT	1 cut(s)	50

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.