Rmu_sc0000831.1_g000016

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000831.1
OG0014266
Physical Location & Seq
Forward (+)
88495 .. 92916
4422 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000831.1_g000016.1.cds

Sequence Viewer

Length: 672 bp
atggcgggggcgaacggtggaggagtcgacgtggaggttagcgaaggcgaggtcaaactgatccagcgagaggacgagactctgttgggtgtcgtcaaccgtgtgattggtgccattttgtttccggaccccaggagtggtgctccgctgtttcatcggatcaagacctctctcgccgagaatggtccgctctttcgggaagcttctagaaacactggacgcagcgttcttaactggactcgtcagggaagtcttctccgagcactcctcgtcatctctgttggcacaatcacttttttggctttgacaggattgcttgtcttcatgctttttttcctggcagcaactttcaatgccattgttatctcgcttttattatctttggcagctgcaggaggattcttggccttcttctttacctgtatagcagctatatacattggagcactatcagttgccgtttttgttgtttccatgacaacaatttctgcgattatagctgttctgataactacaggttggattggattcttttggtttgtgtggctggcaagtaagaaaagtcttagccttgctaagcactcactcagcgtgactggttcaaccatttcggctttctcttatgcaaggcatgctcgtcatcctcaatctgaagacaaggtttcaggttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

223

Amino Acids

23.78

Weight (kDa)

9.79

Isoelectric Point (pI)

22.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014266)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G16550
fragaria_vesca FvH4_1g28640
malus_domestica MD09G1265200.v1.1 MD17G1261400.v1.1
prunus_persica Prupe.3G163400_v2.0.a1
pyrus_communis pycom09g17900 pycom17g26190
rosa_chinensis RchiOBHm_Chr3g0492651
rosa_laevigata RLG00000022752
rosa_multiflora Rmu_sc0000831.1_g000016
rosa_roxburghii Rroxscaffold_6G00392160
rosa_rugosa Rorug03G0255300.1
rosa_samantha Rh3AG305600 Rh3BG342000 Rh3CG339400 Rh3DG341300
rosa_wichuraiana Rw3G026900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 110
AccBSI CCGCTC 1 cut(s) 190
AccI GTMKAC 1 cut(s) 27
AccIII TCCGGA 1 cut(s) 124
AciI CCGC 3 cut(s) 5, 146, 188
AclWI GGATC 2 cut(s) 55, 167
AcuI CTGAAG 1 cut(s) 672
AfiI CCNNNNNNNGG 2 cut(s) 70, 137
AgsI TTSAA 2 cut(s) 352, 603
AjiI CACGTC 1 cut(s) 31
AjnI CCWGG 2 cut(s) 131, 336
AloI GAACNNNNNNTCC 2 cut(s) 210, 242
AluBI AGCT 4 cut(s) 203, 389, 431, 500
AluI AGCT 4 cut(s) 203, 389, 431, 500
Alw21I GWGCWC 3 cut(s) 145, 265, 448
Alw26I GTCTC 1 cut(s) 71
AlwI GGATC 2 cut(s) 55, 167
Aor13HI TCCGGA 1 cut(s) 124
AoxI GGCC 1 cut(s) 405
ApeKI GCWGC 5 cut(s) 222, 341, 386, 389, 428
ArsI GACNNNNNNTTYG 2 cut(s) 36, 68
AspS9I GGNCC 2 cut(s) 127, 185
AvaII GGWCC 2 cut(s) 127, 185
BanI GGYRCC 1 cut(s) 110
BbsI GAAGAC 3 cut(s) 245, 313, 660
Bbv12I GWGCWC 3 cut(s) 145, 265, 448
BbvI GCAGC 5 cut(s) 234, 353, 376, 398, 440
BceAI ACGGC 1 cut(s) 443
BciT130I CCWGG 2 cut(s) 133, 338
BcoDI GTCTC 1 cut(s) 71
BfaI CTAG 1 cut(s) 207
BfmI CTRYAG 2 cut(s) 390, 513
BisI GCNGC 5 cut(s) 223, 342, 387, 390, 429
BlpI GCTNAGC 1 cut(s) 576
BlsI GCNGC 5 cut(s) 224, 343, 388, 391, 430
Bme1390I CCNGG 2 cut(s) 133, 338
Bme18I GGWCC 2 cut(s) 127, 185
BmgBI CACGTC 1 cut(s) 31
BmgT120I GGNCC 2 cut(s) 127, 185
BmiI GGNNCC 2 cut(s) 112, 129
BmrFI CCNGG 2 cut(s) 133, 338
BpiI GAAGAC 3 cut(s) 245, 313, 660
BplI GAGNNNNNCTC 4 cut(s) 127, 159, 252, 284
Bpu1102I GCTNAGC 1 cut(s) 576
BsaJI CCNNGG 1 cut(s) 131
BsaWI WCCGGW 1 cut(s) 124
BsaXI ACNNNNNCTCC 2 cut(s) 15, 45
Bsc4I CCNNNNNNNGG 2 cut(s) 70, 137
Bse1I ACTGG 3 cut(s) 220, 239, 601
BseAI TCCGGA 1 cut(s) 124
BseBI CCWGG 2 cut(s) 133, 338
BseDI CCNNGG 1 cut(s) 131
BseGI GGATG 1 cut(s) 640
BseLI CCNNNNNNNGG 2 cut(s) 70, 137
BseMII CTCAG 1 cut(s) 601
BseNI ACTGG 3 cut(s) 220, 239, 601
BseRI GAGGAG 2 cut(s) 36, 257
BseXI GCAGC 5 cut(s) 234, 353, 376, 398, 440
BshFI GGCC 1 cut(s) 407
BshNI GGYRCC 1 cut(s) 110
BsiHKAI GWGCWC 3 cut(s) 145, 265, 448
BsiSI CCGG 1 cut(s) 125
BslI CCNNNNNNNGG 2 cut(s) 70, 137
BsmAI GTCTC 1 cut(s) 71
BsnI GGCC 1 cut(s) 407
Bsp1286I GDGCHC 3 cut(s) 145, 265, 448
Bsp13I TCCGGA 1 cut(s) 124
Bsp143I GATC 2 cut(s) 60, 159
Bsp1720I GCTNAGC 1 cut(s) 576
BspACI CCGC 3 cut(s) 5, 146, 188
BspANI GGCC 1 cut(s) 407
BspCNI CTCAG 1 cut(s) 600
BspEI TCCGGA 1 cut(s) 124
BspLI GGNNCC 2 cut(s) 112, 129
BspMAI CTGCAG 1 cut(s) 394
BspPI GGATC 2 cut(s) 55, 167
BspT107I GGYRCC 1 cut(s) 110
BsrBI CCGCTC 1 cut(s) 190
BsrI ACTGG 3 cut(s) 220, 239, 601
BssECI CCNNGG 1 cut(s) 131
BssMI GATC 2 cut(s) 60, 159
Bst2UI CCWGG 2 cut(s) 133, 338
Bst4CI ACNGT 2 cut(s) 17, 101
BstAPI GCANNNNNTGC 1 cut(s) 632
BstC8I GCNNGC 2 cut(s) 549, 633
BstDEI CTNAG 3 cut(s) 566, 576, 587
BstF5I GGATG 1 cut(s) 640
BstKTI GATC 2 cut(s) 63, 162
BstMAI GTCTC 1 cut(s) 71
BstMBI GATC 2 cut(s) 60, 159
BstMWI GCNNNNNNNGC 2 cut(s) 497, 632
BstNI CCWGG 2 cut(s) 133, 338
BstNSI RCATGY 1 cut(s) 635
BstSCI CCNGG 2 cut(s) 131, 336
BstSFI CTRYAG 2 cut(s) 390, 513
BstV1I GCAGC 5 cut(s) 234, 353, 376, 398, 440
BstV2I GAAGAC 3 cut(s) 245, 313, 660
BsuRI GGCC 1 cut(s) 407
BtrI CACGTC 1 cut(s) 31
BtsCI GGATG 1 cut(s) 640
BtsIMutI CAGTG 1 cut(s) 213
Cac8I GCNNGC 2 cut(s) 549, 633
Cfr13I GGNCC 2 cut(s) 127, 185
CseI GACGC 1 cut(s) 228
CviAII CATG 3 cut(s) 325, 475, 632
CviJI RGCY 9 cut(s) 203, 302, 389, 407, 431, 500, 547, 570, 614
CviKI_1 RGCY 9 cut(s) 203, 302, 389, 407, 431, 500, 547, 570, 614
DdeI CTNAG 3 cut(s) 566, 576, 587
DpnI GATC 2 cut(s) 62, 161
DpnII GATC 2 cut(s) 60, 159
Eco47I GGWCC 2 cut(s) 127, 185
Eco57I CTGAAG 1 cut(s) 672
EcoRII CCWGG 2 cut(s) 131, 336
FaeI CATG 3 cut(s) 328, 478, 635
FaiI YATR 8 cut(s) 326, 425, 434, 436, 476, 497, 624, 633
FatI CATG 3 cut(s) 324, 474, 631
FblI GTMKAC 1 cut(s) 27
Fnu4HI GCNGC 5 cut(s) 223, 342, 387, 390, 429
FokI GGATG 1 cut(s) 627
Fsp4HI GCNGC 5 cut(s) 223, 342, 387, 390, 429
FspBI CTAG 1 cut(s) 207
GluI GCNGC 5 cut(s) 223, 342, 387, 390, 429
HaeIII GGCC 1 cut(s) 407
HapII CCGG 1 cut(s) 125
HgaI GACGC 1 cut(s) 228
Hin1II CATG 3 cut(s) 328, 478, 635
HincII GTYRAC 2 cut(s) 28, 97
HindII GTYRAC 2 cut(s) 28, 97
HindIII AAGCTT 1 cut(s) 201
HinfI GANTC 5 cut(s) 24, 79, 238, 399, 528
HpaII CCGG 1 cut(s) 125
Hpy166II GTNNAC 2 cut(s) 28, 97
Hpy188I TCNGA 4 cut(s) 159, 260, 507, 652
Hpy188III TCNNGA 4 cut(s) 125, 163, 197, 207
Hpy8I GTNNAC 2 cut(s) 28, 97
Hpy99I CGWCG 1 cut(s) 32
HpyAV CCTTC 2 cut(s) 38, 418
HpyCH4III ACNGT 2 cut(s) 17, 101
HpyCH4IV ACGT 1 cut(s) 30
HpyCH4V TGCA 2 cut(s) 392, 626
HpyF10VI GCNNNNNNNGC 2 cut(s) 497, 632
HpyF3I CTNAG 3 cut(s) 566, 576, 587
HpySE526I ACGT 1 cut(s) 30
Hsp92II CATG 3 cut(s) 328, 478, 635
Kpn2I TCCGGA 1 cut(s) 124
Kzo9I GATC 2 cut(s) 60, 159
LmnI GCTCC 2 cut(s) 148, 443
Lsp1109I GCAGC 5 cut(s) 234, 353, 376, 398, 440
MaeI CTAG 1 cut(s) 207
MaeII ACGT 1 cut(s) 30
MaeIII GTNAC 1 cut(s) 592
MalI GATC 2 cut(s) 62, 161
MbiI CCGCTC 1 cut(s) 190
MboI GATC 2 cut(s) 60, 159
MboII GAAGA 4 cut(s) 245, 313, 403, 665
MhlI GDGCHC 3 cut(s) 145, 265, 448
MluCI AATT 1 cut(s) 483
MlyI GAGTC 3 cut(s) 33, 73, 232
MmeI TCCRAC 1 cut(s) 500
MnlI CCTC 8 cut(s) 14, 28, 43, 64, 178, 278, 389, 654
MroI TCCGGA 1 cut(s) 124
MseI TTAA 1 cut(s) 231
MspA1I CMGCKG 2 cut(s) 148, 389
MspI CCGG 1 cut(s) 125
MspR9I CCNGG 2 cut(s) 133, 338
MvaI CCWGG 2 cut(s) 133, 338
MwoI GCNNNNNNNGC 2 cut(s) 497, 632
NdeII GATC 2 cut(s) 60, 159
NlaIII CATG 3 cut(s) 328, 478, 635
NlaIV GGNNCC 2 cut(s) 112, 129
NmeAIII GCCGAG 1 cut(s) 202
NmuCI GTSAC 1 cut(s) 592
NspI RCATGY 1 cut(s) 635
PaeI GCATGC 1 cut(s) 635
PfeI GAWTC 2 cut(s) 399, 528
PkrI GCNGC 5 cut(s) 224, 343, 388, 391, 430
PleI GAGTC 3 cut(s) 32, 73, 232
PpsI GAGTC 3 cut(s) 32, 73, 232
Psp6I CCWGG 2 cut(s) 131, 336
PspGI CCWGG 2 cut(s) 131, 336
PspN4I GGNNCC 2 cut(s) 112, 129
PspPI GGNCC 2 cut(s) 127, 185
PstI CTGCAG 1 cut(s) 394
PvuII CAGCTG 1 cut(s) 389
SalI GTCGAC 1 cut(s) 26
SaqAI TTAA 1 cut(s) 231
SatI GCNGC 5 cut(s) 223, 342, 387, 390, 429
Sau3AI GATC 2 cut(s) 60, 159
Sau96I GGNCC 2 cut(s) 127, 185
SchI GAGTC 3 cut(s) 33, 73, 232
ScrFI CCNGG 2 cut(s) 133, 338
SduI GDGCHC 3 cut(s) 145, 265, 448
SfcI CTRYAG 2 cut(s) 390, 513
SinI GGWCC 2 cut(s) 127, 185
SphI GCATGC 1 cut(s) 635
Sse9I AATT 1 cut(s) 483
SsiI CCGC 3 cut(s) 5, 146, 188
SspMI CTAG 1 cut(s) 207
StyD4I CCNGG 2 cut(s) 131, 336
TaaI ACNGT 2 cut(s) 17, 101
TaiI ACGT 1 cut(s) 33
TaqI TCGA 1 cut(s) 27
TasI AATT 1 cut(s) 483
TfiI GAWTC 2 cut(s) 399, 528
Tru1I TTAA 1 cut(s) 231
Tru9I TTAA 1 cut(s) 231
TscAI CASTG 1 cut(s) 220
TseFI GTSAC 1 cut(s) 592
TseI GCWGC 5 cut(s) 222, 341, 386, 389, 428
Tsp45I GTSAC 1 cut(s) 592
TspDTI ATGAA 2 cut(s) 143, 313
TspRI CASTG 1 cut(s) 220
VpaK11BI GGWCC 2 cut(s) 127, 185
XbaI TCTAGA 1 cut(s) 206
XceI RCATGY 1 cut(s) 635
XmiI GTMKAC 1 cut(s) 27
XspI CTAG 1 cut(s) 207
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.