Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000954.1

Orthogroup ID

OG0005923

Physical Location & Seq

Genomic Coordinates Reverse (-)

33342 .. 37116

Gene Structure 3775 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000954.1_g000009.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1260 bp

atgcagttaagtattccaggatgtataaaaataagtgttgagagcatcttgttaaacctaaggaccttgaagtctgcaggcaaacctggaataaagcagttaagaattggaggtctctctggtataacagacaagcagttcgaagagttaaaattcttgctgggtgcagataaccatacccaggttaaagccccaaaaccacggtattttcatggtgggctatcgtacctctcttgtgatgatgattgcgccattgacattgaagcatgccccaggtgccagagactaagtttagtttatgattgcccagcagagagttgccaagggaaatatcagaaggctcagatgtgcagggcttgcatactctgcataactcgctgtattagctgtgggtgttgccttggagactgcgattatgtggagacgttttgcctacagttgctttgtttggaatgtttggagaacctactcaactgtcaagagaggcatggagaaaatggtgctaccaaatgtgccatattttgtcaggagagcagctacaaagtaaaaagcgaacctcgtagggtttcgagtctaggtggcggggtcggcggccatctgcttgcagcgtcggtgacaggcttgacgggtttcacaggtaggagacggtttgacgggtctggtggcttgcttccgatctcgggatcagtggttaactggttttggtcggagctaaccagcatggtggttgatcaaaggcggcggcggttggttggctggccttctcgaggtcggggatcactttttttggcgacgggaattgaggcaattcgatccttgattccggtcggttgtcgcagcttttgggtaggtggttgtcgactggattttgcagttggagaccaagcagccagccgccggacagatttgcgacggcggcaacaatggagcggcctagggcttctgcccagttttctcgtggtcggttgtcgcagcttttgggtaggtggttgtcgcctggattttgcagtcggagacaaagcagttctgatatcgatctgcagcagattacttgcaggttttcagtgcttgatgggatgctggcaaggccggccgccgaacagattggcgacggtggcggcaatggagcgatctagggcttctgcccagttttctcgggtttgggttggggtctttgggccttggctcaaatccgggttggtgggccttaattcgtgggcttgtaaggagggtgccttgccaccctcacttgtcacttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

F-box-like

Protein Analysis

419

Amino Acids

45.65

Weight (kDa)

9.07

Isoelectric Point (pI)

48.76

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005923)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_6g52710 FvH4_6g52710 FvH4_6g52710
malus_domestica	MD09G1017100.v1.1 MD17G1017800.v1.1
prunus_persica	Prupe.3G300300_v2.0.a1 Prupe.3G300300_v2.0.a1 Prupe.3G300300_v2.0.a1
pyrus_communis	pycom111g01390 pycom17g01420 pycom17g01430
rosa_chinensis	RchiOBHm_Chr2g0174221 RchiOBHm_Chr2g0174321
rosa_laevigata	RLG00000022257
rosa_multiflora	Rmu_sc0000954.1_g000005 Rmu_sc0000954.1_g000009 Rmu_sc0007150.1_g000009 Rmu_sc0015388.1_g000001
rosa_roxburghii	Rroxscaffold_2G00078320
rosa_rugosa	Rorug02G0576100
rosa_samantha	Rh2AG655700 Rh2AG655900 Rh2BG666900 Rh2BG667100 Rh2CG630800 Rh2DG681300 Rh2DG681600
rosa_wichuraiana	Rw2G053800

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	70
Acc36I	ACCTGC	1 cut(s)	1046
AccB1I	GGYRCC	2 cut(s)	276, 1232
AccBSI	CCGCTC	1 cut(s)	930
AccI	GTMKAC	1 cut(s)	859
AclWI	GGATC	3 cut(s)	691, 784, 807
AcoI	YGGCCR	2 cut(s)	592, 1091
AcsI	RAATTY	1 cut(s)	152
AfaI	GTAC	1 cut(s)	227
AfiI	CCNNNNNNNGG	4 cut(s)	181, 680, 767, 897
AgsI	TTSAA	2 cut(s)	70, 263
AjnI	CCWGG	5 cut(s)	16, 85, 180, 272, 996
AluBI	AGCT	5 cut(s)	387, 537, 712, 840, 975
AluI	AGCT	5 cut(s)	387, 537, 712, 840, 975
Alw26I	GTCTC	7 cut(s)	119, 277, 399, 416, 637, 873, 1008
AlwI	GGATC	3 cut(s)	691, 784, 807
Ama87I	CYCGRG	3 cut(s)	679, 765, 1155
AoxI	GGCC	7 cut(s)	592, 758, 931, 1087, 1091, 1178, 1204
ApeKI	GCWGC	6 cut(s)	534, 605, 837, 887, 972, 1041
ApoI	RAATTY	1 cut(s)	152
ArsI	GACNNNNNNTTYG	2 cut(s)	122, 154
AspA2I	CCTAGG	1 cut(s)	934
AspLEI	GCGC	1 cut(s)	251
AspS9I	GGNCC	3 cut(s)	63, 1178, 1204
AsuC2I	CCSGG	1 cut(s)	1195
AsuHPI	GGTGA	1 cut(s)	625
AsuII	TTCGAA	1 cut(s)	141
AvaI	CYCGRG	3 cut(s)	679, 765, 1155
AvaII	GGWCC	1 cut(s)	63
AvrII	CCTAGG	1 cut(s)	934
AxyI	CCTNAGG	1 cut(s)	59
BanI	GGYRCC	2 cut(s)	276, 1232
BauI	CACGAG	1 cut(s)	956
BbvI	GCAGC	6 cut(s)	546, 617, 849, 899, 984, 1053
BccI	CCATC	2 cut(s)	603, 1066
BceAI	ACGGC	1 cut(s)	929
BciT130I	CCWGG	5 cut(s)	18, 87, 182, 274, 998
BclI	TGATCA	1 cut(s)	730
BcnI	CCSGG	1 cut(s)	1195
BcoDI	GTCTC	7 cut(s)	119, 277, 399, 416, 637, 873, 1008
BfaI	CTAG	3 cut(s)	575, 935, 1134
BfmI	CTRYAG	3 cut(s)	75, 434, 1039
BfuAI	ACCTGC	1 cut(s)	1046
BlnI	CCTAGG	1 cut(s)	934
Bme1390I	CCNGG	6 cut(s)	18, 87, 182, 274, 998, 1195
Bme18I	GGWCC	1 cut(s)	63
BmeT110I	CYCGRG	3 cut(s)	679, 765, 1155
BmgT120I	GGNCC	3 cut(s)	63, 1178, 1204
BmiI	GGNNCC	2 cut(s)	278, 1234
BmrFI	CCNGG	6 cut(s)	18, 87, 182, 274, 998, 1195
BmrI	ACTGGG	2 cut(s)	942, 1141
BmsI	GCATC	2 cut(s)	54, 1067
BmuI	ACTGGG	2 cut(s)	942, 1141
Bpu14I	TTCGAA	1 cut(s)	141
BpuMI	CCSGG	1 cut(s)	1195
Bsa29I	ATCGAT	1 cut(s)	1034
BsaBI	GATNNNNATC	1 cut(s)	1034
BsaI	GGTCTC	2 cut(s)	119, 873
BsaJI	CCNNGG	7 cut(s)	180, 200, 272, 322, 400, 934, 1181
BsaWI	WCCGGW	1 cut(s)	823
Bsc4I	CCNNNNNNNGG	4 cut(s)	181, 680, 767, 897
Bse118I	RCCGGY	1 cut(s)	1089
Bse1I	ACTGG	4 cut(s)	701, 867, 948, 1147
Bse21I	CCTNAGG	1 cut(s)	59
Bse3DI	GCAATG	1 cut(s)	1128
Bse8I	GATNNNNATC	1 cut(s)	1034
BseBI	CCWGG	5 cut(s)	18, 87, 182, 274, 998
BseCI	ATCGAT	1 cut(s)	1034
BseDI	CCNNGG	7 cut(s)	180, 200, 272, 322, 400, 934, 1181
BseGI	GGATG	2 cut(s)	26, 1082
BseJI	GATNNNNATC	1 cut(s)	1034
BseLI	CCNNNNNNNGG	4 cut(s)	181, 680, 767, 897
BseMI	GCAATG	1 cut(s)	1128
BseMII	CTCAG	1 cut(s)	356
BseNI	ACTGG	4 cut(s)	701, 867, 948, 1147
BseX3I	CGGCCG	1 cut(s)	1091
BseXI	GCAGC	6 cut(s)	546, 617, 849, 899, 984, 1053
BseYI	CCCAGC	2 cut(s)	160, 307
BsgI	GTGCAG	2 cut(s)	186, 370
Bsh1285I	CGRYCG	2 cut(s)	828, 1094
BshFI	GGCC	7 cut(s)	594, 760, 933, 1089, 1093, 1180, 1206
BshNI	GGYRCC	2 cut(s)	276, 1232
BshVI	ATCGAT	1 cut(s)	1034
BsiEI	CGRYCG	2 cut(s)	828, 1094
BsiHKCI	CYCGRG	3 cut(s)	679, 765, 1155
BsiSI	CCGG	4 cut(s)	824, 898, 1090, 1194
BslI	CCNNNNNNNGG	4 cut(s)	181, 680, 767, 897
BsmAI	GTCTC	7 cut(s)	119, 277, 399, 416, 637, 873, 1008
BsmBI	CGTCTC	2 cut(s)	416, 637
BsnI	GGCC	7 cut(s)	594, 760, 933, 1089, 1093, 1180, 1206
Bso31I	GGTCTC	2 cut(s)	119, 873
BsoBI	CYCGRG	3 cut(s)	679, 765, 1155
Bsp119I	TTCGAA	1 cut(s)	141
Bsp143I	GATC	7 cut(s)	675, 683, 730, 776, 812, 1035, 1130
BspANI	GGCC	7 cut(s)	594, 760, 933, 1089, 1093, 1180, 1206
BspCNI	CTCAG	1 cut(s)	355
BspDI	ATCGAT	1 cut(s)	1034
BspLI	GGNNCC	2 cut(s)	278, 1234
BspMAI	CTGCAG	2 cut(s)	79, 1043
BspMI	ACCTGC	1 cut(s)	1046
BspPI	GGATC	3 cut(s)	691, 784, 807
BspT104I	TTCGAA	1 cut(s)	141
BspT107I	GGYRCC	2 cut(s)	276, 1232
BspTNI	GGTCTC	2 cut(s)	119, 873
BsrBI	CCGCTC	1 cut(s)	930
BsrDI	GCAATG	1 cut(s)	1128
BsrFI	RCCGGY	1 cut(s)	1089
BsrI	ACTGG	4 cut(s)	701, 867, 948, 1147
BssAI	RCCGGY	1 cut(s)	1089
BssECI	CCNNGG	7 cut(s)	180, 200, 272, 322, 400, 934, 1181
BssMI	GATC	7 cut(s)	675, 683, 730, 776, 812, 1035, 1130
BssSI	CACGAG	1 cut(s)	956
BssT1I	CCWWGG	4 cut(s)	322, 400, 934, 1181
Bst2BI	CACGAG	1 cut(s)	956
Bst2UI	CCWGG	5 cut(s)	18, 87, 182, 274, 998
Bst4CI	ACNGT	5 cut(s)	204, 438, 476, 648, 1114
Bst6I	CTCTTC	1 cut(s)	138
BstAPI	GCANNNNNTGC	2 cut(s)	357, 366
BstBI	TTCGAA	1 cut(s)	141
BstC8I	GCNNGC	9 cut(s)	79, 268, 358, 603, 668, 758, 892, 1082, 1091
BstDEI	CTNAG	4 cut(s)	59, 287, 342, 1257
BstDSI	CCRYGG	1 cut(s)	200
BstENI	CCTNNNNNAGG	1 cut(s)	765
BstF5I	GGATG	2 cut(s)	26, 1082
BstHHI	GCGC	1 cut(s)	251
BstKTI	GATC	7 cut(s)	678, 686, 733, 779, 815, 1038, 1133
BstMAI	GTCTC	7 cut(s)	119, 277, 399, 416, 637, 873, 1008
BstMBI	GATC	7 cut(s)	675, 683, 730, 776, 812, 1035, 1130
BstMCI	CGRYCG	2 cut(s)	828, 1094
BstNI	CCWGG	5 cut(s)	18, 87, 182, 274, 998
BstNSI	RCATGY	1 cut(s)	270
BstSCI	CCNGG	6 cut(s)	16, 85, 180, 272, 996, 1193
BstSFI	CTRYAG	3 cut(s)	75, 434, 1039
BstV1I	GCAGC	6 cut(s)	546, 617, 849, 899, 984, 1053
BstXI	CCANNNNNNTGG	1 cut(s)	724
BstZI	CGGCCG	1 cut(s)	1091
Bsu15I	ATCGAT	1 cut(s)	1034
Bsu36I	CCTNAGG	1 cut(s)	59
BsuRI	GGCC	7 cut(s)	594, 760, 933, 1089, 1093, 1180, 1206
BsuTUI	ATCGAT	1 cut(s)	1034
BtgI	CCRYGG	1 cut(s)	200
BtsCI	GGATG	2 cut(s)	26, 1082
BtsIMutI	CAGTG	2 cut(s)	693, 1070
BveI	ACCTGC	1 cut(s)	1046
Cac8I	GCNNGC	9 cut(s)	79, 268, 358, 603, 668, 758, 892, 1082, 1091
CfoI	GCGC	1 cut(s)	251
Cfr10I	RCCGGY	1 cut(s)	1089
Cfr13I	GGNCC	3 cut(s)	63, 1178, 1204
ClaI	ATCGAT	1 cut(s)	1034
CseI	GACGC	1 cut(s)	597
Csp6I	GTAC	1 cut(s)	226
CviAII	CATG	4 cut(s)	212, 267, 488, 721
CviQI	GTAC	1 cut(s)	226
DdeI	CTNAG	4 cut(s)	59, 287, 342, 1257
DpnI	GATC	7 cut(s)	677, 685, 732, 778, 814, 1037, 1132
DpnII	GATC	7 cut(s)	675, 683, 730, 776, 812, 1035, 1130
DrdI	GACNNNNNNGTC	1 cut(s)	70
DseDI	GACNNNNNNGTC	1 cut(s)	70
EaeI	YGGCCR	2 cut(s)	592, 1091
EagI	CGGCCG	1 cut(s)	1091
Eam1104I	CTCTTC	1 cut(s)	138
EarI	CTCTTC	1 cut(s)	138
EclXI	CGGCCG	1 cut(s)	1091
Eco130I	CCWWGG	4 cut(s)	322, 400, 934, 1181
Eco31I	GGTCTC	2 cut(s)	119, 873
Eco32I	GATATC	1 cut(s)	1032
Eco47I	GGWCC	1 cut(s)	63
Eco52I	CGGCCG	1 cut(s)	1091
Eco81I	CCTNAGG	1 cut(s)	59
Eco88I	CYCGRG	3 cut(s)	679, 765, 1155
EcoNI	CCTNNNNNAGG	1 cut(s)	765
EcoO109I	RGGNCCY	1 cut(s)	63
EcoRII	CCWGG	5 cut(s)	16, 85, 180, 272, 996
EcoRV	GATATC	1 cut(s)	1032
EcoT14I	CCWWGG	4 cut(s)	322, 400, 934, 1181
ErhI	CCWWGG	4 cut(s)	322, 400, 934, 1181
Esp3I	CGTCTC	2 cut(s)	416, 637
FaeI	CATG	4 cut(s)	215, 270, 491, 724
FatI	CATG	4 cut(s)	211, 266, 487, 720
FauI	CCCGC	1 cut(s)	575
FbaI	TGATCA	1 cut(s)	730
FblI	GTMKAC	1 cut(s)	859
FokI	GGATG	2 cut(s)	33, 1089
FseI	GGCCGGCC	1 cut(s)	1093
FspBI	CTAG	3 cut(s)	575, 935, 1134
GlaI	GCGC	1 cut(s)	250
GsaI	CCCAGC	2 cut(s)	164, 311
HaeIII	GGCC	7 cut(s)	594, 760, 933, 1089, 1093, 1180, 1206
HapII	CCGG	4 cut(s)	824, 898, 1090, 1194
HgaI	GACGC	1 cut(s)	597
HhaI	GCGC	1 cut(s)	251
Hin1II	CATG	4 cut(s)	215, 270, 491, 724
Hin6I	GCGC	1 cut(s)	249
HinP1I	GCGC	1 cut(s)	249
HincII	GTYRAC	2 cut(s)	694, 860
HindII	GTYRAC	2 cut(s)	694, 860
HinfI	GANTC	2 cut(s)	571, 820
HpaI	GTTAAC	1 cut(s)	694
HpaII	CCGG	4 cut(s)	824, 898, 1090, 1194
HphI	GGTGA	1 cut(s)	625
Hpy166II	GTNNAC	2 cut(s)	694, 860
Hpy188I	TCNGA	6 cut(s)	336, 345, 675, 709, 1013, 1029
Hpy188III	TCNNGA	4 cut(s)	479, 527, 681, 765
Hpy8I	GTNNAC	2 cut(s)	694, 860
Hpy99I	CGWCG	4 cut(s)	613, 796, 915, 1114
HpyAV	CCTTC	2 cut(s)	331, 771
HpyCH4III	ACNGT	5 cut(s)	204, 438, 476, 648, 1114
HpyCH4IV	ACGT	1 cut(s)	425
HpyF3I	CTNAG	4 cut(s)	59, 287, 342, 1257
HpySE526I	ACGT	1 cut(s)	425
Hsp92II	CATG	4 cut(s)	215, 270, 491, 724
HspAI	GCGC	1 cut(s)	249
KroI	GCCGGC	1 cut(s)	1089
KroNI	GCCGGC	1 cut(s)	1091
Ksp22I	TGATCA	1 cut(s)	730
KspAI	GTTAAC	1 cut(s)	694
Kzo9I	GATC	7 cut(s)	675, 683, 730, 776, 812, 1035, 1130
LmnI	GCTCC	3 cut(s)	709, 927, 1126
Lsp1109I	GCAGC	6 cut(s)	546, 617, 849, 899, 984, 1053
LweI	GCATC	2 cut(s)	54, 1067
MaeI	CTAG	3 cut(s)	575, 935, 1134
MaeII	ACGT	1 cut(s)	425
MaeIII	GTNAC	2 cut(s)	613, 1252
MalI	GATC	7 cut(s)	677, 685, 732, 778, 814, 1037, 1132
MbiI	CCGCTC	1 cut(s)	930
MboI	GATC	7 cut(s)	675, 683, 730, 776, 812, 1035, 1130
MboII	GAAGA	1 cut(s)	155
MluCI	AATT	5 cut(s)	105, 152, 798, 807, 1210
MlyI	GAGTC	1 cut(s)	580
MmeI	TCCRAC	3 cut(s)	687, 856, 991
MnlI	CCTC	8 cut(s)	104, 239, 477, 567, 761, 796, 1222, 1255
MroNI	GCCGGC	1 cut(s)	1089
MseI	TTAA	7 cut(s)	8, 53, 101, 149, 186, 693, 1209
MspI	CCGG	4 cut(s)	824, 898, 1090, 1194
MspR9I	CCNGG	6 cut(s)	18, 87, 182, 274, 998, 1195
MvaI	CCWGG	5 cut(s)	18, 87, 182, 274, 998
NaeI	GCCGGC	1 cut(s)	1091
NciI	CCSGG	1 cut(s)	1195
NdeII	GATC	7 cut(s)	675, 683, 730, 776, 812, 1035, 1130
NgoMIV	GCCGGC	1 cut(s)	1089
NlaIII	CATG	4 cut(s)	215, 270, 491, 724
NlaIV	GGNNCC	2 cut(s)	278, 1234
NmuCI	GTSAC	2 cut(s)	613, 1252
NspI	RCATGY	1 cut(s)	270
NspV	TTCGAA	1 cut(s)	141
PaeI	GCATGC	1 cut(s)	270
PaeR7I	CTCGAG	1 cut(s)	765
PdiI	GCCGGC	1 cut(s)	1091
PfeI	GAWTC	1 cut(s)	820
PfoI	TCCNGGA	1 cut(s)	16
PleI	GAGTC	1 cut(s)	579
PpsI	GAGTC	1 cut(s)	579
PpuMI	RGGWCCY	1 cut(s)	63
Psp5II	RGGWCCY	1 cut(s)	63
Psp6I	CCWGG	5 cut(s)	16, 85, 180, 272, 996
PspFI	CCCAGC	2 cut(s)	160, 307
PspGI	CCWGG	5 cut(s)	16, 85, 180, 272, 996
PspN4I	GGNNCC	2 cut(s)	278, 1234
PspPI	GGNCC	3 cut(s)	63, 1178, 1204
PspPPI	RGGWCCY	1 cut(s)	63
PstI	CTGCAG	2 cut(s)	79, 1043
RigI	GGCCGGCC	1 cut(s)	1093
RsaI	GTAC	1 cut(s)	227
RsaNI	GTAC	1 cut(s)	226
SalI	GTCGAC	1 cut(s)	858
SaqAI	TTAA	7 cut(s)	8, 53, 101, 149, 186, 693, 1209
Sau3AI	GATC	7 cut(s)	675, 683, 730, 776, 812, 1035, 1130
Sau96I	GGNCC	3 cut(s)	63, 1178, 1204
SchI	GAGTC	1 cut(s)	580
ScrFI	CCNGG	6 cut(s)	18, 87, 182, 274, 998, 1195
SfaNI	GCATC	2 cut(s)	54, 1067
SfcI	CTRYAG	3 cut(s)	75, 434, 1039
Sfr274I	CTCGAG	1 cut(s)	765
SfuI	TTCGAA	1 cut(s)	141
SinI	GGWCC	1 cut(s)	63
SlaI	CTCGAG	1 cut(s)	765
SmlI	CTYRAG	1 cut(s)	765
SmoI	CTYRAG	1 cut(s)	765
SphI	GCATGC	1 cut(s)	270
Sse9I	AATT	5 cut(s)	105, 152, 798, 807, 1210
SspMI	CTAG	3 cut(s)	575, 935, 1134
StyD4I	CCNGG	6 cut(s)	16, 85, 180, 272, 996, 1193
StyI	CCWWGG	4 cut(s)	322, 400, 934, 1181
TaaI	ACNGT	5 cut(s)	204, 438, 476, 648, 1114
TaiI	ACGT	1 cut(s)	428
TaqI	TCGA	6 cut(s)	141, 569, 766, 811, 859, 1034
TasI	AATT	5 cut(s)	105, 152, 798, 807, 1210
TauI	GCSGC	8 cut(s)	594, 742, 745, 897, 919, 933, 1096, 1121
TfiI	GAWTC	1 cut(s)	820
Tru1I	TTAA	7 cut(s)	8, 53, 101, 149, 186, 693, 1209
Tru9I	TTAA	7 cut(s)	8, 53, 101, 149, 186, 693, 1209
TscAI	CASTG	2 cut(s)	693, 1070
TseFI	GTSAC	2 cut(s)	613, 1252
TseI	GCWGC	6 cut(s)	534, 605, 837, 887, 972, 1041
Tsp45I	GTSAC	2 cut(s)	613, 1252
TspDTI	ATGAA	1 cut(s)	200
TspRI	CASTG	2 cut(s)	693, 1070
VpaK11BI	GGWCC	1 cut(s)	63
XagI	CCTNNNNNAGG	1 cut(s)	765
XapI	RAATTY	1 cut(s)	152
XceI	RCATGY	1 cut(s)	270
XcmI	CCANNNNNNNNNTGG	1 cut(s)	955
XhoI	CTCGAG	1 cut(s)	765
XmaJI	CCTAGG	1 cut(s)	934
XmiI	GTMKAC	1 cut(s)	859
XspI	CTAG	3 cut(s)	575, 935, 1134

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.