Rmu_sc0000976.1_g000003

EF-hand domain pair

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000976.1
Physical Location & Seq
Reverse (-)
7374 .. 10032
2659 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000976.1_g000003.1.cds

Sequence Viewer

Length: 510 bp
atggagaacgcgactcttctcagagaatggttcgcgcgagttgactcagagaaaaccggaagcatcactgcccctcagctcaagaatgctctcgccgttggaaacctcgaattccctctctcaattgttcagcagatgatcaggatgtatgattttgatagaaatggaactatgagctttgaagagtttgttgccctcaacaagttcctactaaaggttcaacaagctttctcagagcgagagaggggtcggggctatctcgttcctgatgatgtgtatgaggcattggggaaaattggtttcttcctggactcccctgctttctacacagtctgcgagagctttgatcaaaagaagaatggaatgttccgactagctgacttcatatctctttgtatatttgtgcagtctgctcgtaatctgttcaattcatttgatacagctaagcaaggcagagtgactcttgatctcaaccaattcgtctattgcactgccaattgcagaatataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

169

Amino Acids

19.38

Weight (kDa)

5.56

Isoelectric Point (pI)

30.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015545)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 3 cut(s) 11, 35, 37
AcsI RAATTY 1 cut(s) 110
AfiI CCNNNNNNNGG 1 cut(s) 214
AgsI TTSAA 3 cut(s) 182, 221, 427
AjnI CCWGG 1 cut(s) 306
AluBI AGCT 6 cut(s) 79, 177, 227, 342, 377, 443
AluI AGCT 6 cut(s) 79, 177, 227, 342, 377, 443
ApoI RAATTY 1 cut(s) 110
AspLEI GCGC 1 cut(s) 37
BbvCI CCTCAGC 1 cut(s) 75
BceAI ACGGC 1 cut(s) 80
BcgI CGANNNNNNTGC 2 cut(s) 395, 429
BciT130I CCWGG 1 cut(s) 308
BclI TGATCA 2 cut(s) 138, 346
BfaI CTAG 1 cut(s) 374
BlpI GCTNAGC 1 cut(s) 444
Bme1390I CCNGG 1 cut(s) 308
BmrFI CCNGG 1 cut(s) 308
BmsI GCATC 1 cut(s) 72
Bpu10I CCTNAGC 1 cut(s) 75
Bpu1102I GCTNAGC 1 cut(s) 444
BpuEI CTTGAG 1 cut(s) 65
BsaWI WCCGGW 1 cut(s) 56
Bsc4I CCNNNNNNNGG 1 cut(s) 214
BseBI CCWGG 1 cut(s) 308
BseGI GGATG 1 cut(s) 150
BseLI CCNNNNNNNGG 1 cut(s) 214
BseMII CTCAG 4 cut(s) 34, 60, 89, 246
BsgI GTGCAG 1 cut(s) 425
Bsh1236I CGCG 3 cut(s) 11, 35, 37
BsiSI CCGG 1 cut(s) 57
BslI CCNNNNNNNGG 1 cut(s) 214
BsmI GAATGC 1 cut(s) 91
Bsp143I GATC 3 cut(s) 138, 346, 466
Bsp1720I GCTNAGC 1 cut(s) 444
BspCNI CTCAG 4 cut(s) 33, 59, 88, 245
BspFNI CGCG 3 cut(s) 11, 35, 37
BssMI GATC 3 cut(s) 138, 346, 466
Bst2UI CCWGG 1 cut(s) 308
Bst4CI ACNGT 1 cut(s) 331
Bst6I CTCTTC 2 cut(s) 21, 177
BstDEI CTNAG 5 cut(s) 20, 46, 75, 232, 444
BstENI CCTNNNNNAGG 1 cut(s) 212
BstF5I GGATG 1 cut(s) 150
BstFNI CGCG 3 cut(s) 11, 35, 37
BstHHI GCGC 1 cut(s) 37
BstKTI GATC 3 cut(s) 141, 349, 469
BstMBI GATC 3 cut(s) 138, 346, 466
BstNI CCWGG 1 cut(s) 308
BstSCI CCNGG 1 cut(s) 306
BstUI CGCG 3 cut(s) 11, 35, 37
BtsCI GGATG 1 cut(s) 150
BtsI GCAGTG 2 cut(s) 66, 489
BtsIMutI CAGTG 2 cut(s) 66, 489
CfoI GCGC 1 cut(s) 37
CviJI RGCY 7 cut(s) 79, 177, 227, 255, 342, 377, 443
CviKI_1 RGCY 7 cut(s) 79, 177, 227, 255, 342, 377, 443
DdeI CTNAG 5 cut(s) 20, 46, 75, 232, 444
DpnI GATC 3 cut(s) 140, 348, 468
DpnII GATC 3 cut(s) 138, 346, 466
Eam1104I CTCTTC 2 cut(s) 21, 177
EarI CTCTTC 2 cut(s) 21, 177
EcoNI CCTNNNNNAGG 1 cut(s) 212
EcoRI GAATTC 1 cut(s) 110
EcoRII CCWGG 1 cut(s) 306
FaiI YATR 6 cut(s) 150, 173, 279, 386, 398, 508
FbaI TGATCA 2 cut(s) 138, 346
FokI GGATG 1 cut(s) 157
FspBI CTAG 1 cut(s) 374
GlaI GCGC 1 cut(s) 36
HapII CCGG 1 cut(s) 57
HhaI GCGC 1 cut(s) 37
Hin6I GCGC 1 cut(s) 35
HinP1I GCGC 1 cut(s) 35
HincII GTYRAC 1 cut(s) 43
HindII GTYRAC 1 cut(s) 43
HindIII AAGCTT 1 cut(s) 225
HinfI GANTC 4 cut(s) 13, 44, 311, 460
HpaII CCGG 1 cut(s) 57
Hpy166II GTNNAC 1 cut(s) 43
Hpy188I TCNGA 4 cut(s) 23, 49, 235, 371
Hpy188III TCNNGA 4 cut(s) 82, 142, 266, 464
Hpy8I GTNNAC 1 cut(s) 43
HpyCH4III ACNGT 1 cut(s) 331
HpyCH4V TGCA 3 cut(s) 406, 489, 501
HpyF3I CTNAG 5 cut(s) 20, 46, 75, 232, 444
HspAI GCGC 1 cut(s) 35
Ksp22I TGATCA 2 cut(s) 138, 346
Kzo9I GATC 3 cut(s) 138, 346, 466
LpnPI CCDG 6 cut(s) 70, 127, 279, 293, 320, 330
LweI GCATC 1 cut(s) 72
MaeI CTAG 1 cut(s) 374
MaeIII GTNAC 1 cut(s) 457
MalI GATC 3 cut(s) 140, 348, 468
MboI GATC 3 cut(s) 138, 346, 466
MboII GAAGA 4 cut(s) 8, 194, 295, 367
MfeI CAATTG 2 cut(s) 123, 496
MluCI AATT 6 cut(s) 110, 123, 294, 427, 476, 496
MlyI GAGTC 4 cut(s) 7, 38, 305, 454
MmeI TCCRAC 2 cut(s) 79, 394
MnlI CCTC 6 cut(s) 84, 116, 126, 206, 237, 274
MspI CCGG 1 cut(s) 57
MspR9I CCNGG 1 cut(s) 308
MunI CAATTG 2 cut(s) 123, 496
Mva1269I GAATGC 1 cut(s) 91
MvaI CCWGG 1 cut(s) 308
MvnI CGCG 3 cut(s) 11, 35, 37
NdeII GATC 3 cut(s) 138, 346, 466
NmuCI GTSAC 1 cut(s) 457
PctI GAATGC 1 cut(s) 91
PfoI TCCNGGA 1 cut(s) 306
PleI GAGTC 4 cut(s) 7, 38, 305, 454
PpsI GAGTC 4 cut(s) 7, 38, 305, 454
Psp6I CCWGG 1 cut(s) 306
PspGI CCWGG 1 cut(s) 306
Sau3AI GATC 3 cut(s) 138, 346, 466
SchI GAGTC 4 cut(s) 7, 38, 305, 454
ScrFI CCNGG 1 cut(s) 308
SetI ASST 8 cut(s) 81, 108, 179, 219, 229, 344, 379, 445
SfaNI GCATC 1 cut(s) 72
SmlI CTYRAG 1 cut(s) 80
SmoI CTYRAG 1 cut(s) 80
Sse9I AATT 6 cut(s) 110, 123, 294, 427, 476, 496
SspMI CTAG 1 cut(s) 374
StyD4I CCNGG 1 cut(s) 306
TaaI ACNGT 1 cut(s) 331
TaqI TCGA 1 cut(s) 108
TasI AATT 6 cut(s) 110, 123, 294, 427, 476, 496
TscAI CASTG 2 cut(s) 73, 496
TseFI GTSAC 1 cut(s) 457
Tsp45I GTSAC 1 cut(s) 457
TspDTI ATGAA 2 cut(s) 373, 420
TspRI CASTG 2 cut(s) 73, 496
XagI CCTNNNNNAGG 1 cut(s) 212
XapI RAATTY 1 cut(s) 110
XspI CTAG 1 cut(s) 374
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.