Rmu_sc0000998.1_g000022

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000998.1
OG0017134
Physical Location & Seq
Reverse (-)
83054 .. 88223
5170 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000998.1_g000022.1.cds

Sequence Viewer

Length: 483 bp
atggggtcggttggtttgttaggcgacgtgaagaaaagaattgcagatggggttgaggataagcaggaagctgtagctgtgaccactgctatccaagaagagatatttctggaaatgggtattgatccaaggtttggcatatcatgcctgggaaaggtgaatataaactatgagaatgatcaggatatgatgattcgcttctataagttcattgcaagggaagagttggcctgtgatgaagccgagcttggagcagatgagtttgctgaaaggatgcagattcaagaaaaaatgcagcagcagcaactggagatgctgaagcaaatgcgcaaatttcccctagatgatcaatctgcagtcctagaaaagttgcgccagcagatggaaatcaccaactttgaggatgctgcatcagtattgtcatgggagcagattcaggagattgttcaaaggagggtatcacctttatttaaccccaagtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

160

Amino Acids

18.47

Weight (kDa)

4.56

Isoelectric Point (pI)

52.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017134)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G27050
fragaria_vesca FvH4_6g53561
malus_domestica MD09G1010400.v1.1 MD16G1254400.v1.1
prunus_persica Prupe.3G306700_v2.0.a1
pyrus_communis pycom111g00830
rosa_chinensis RchiOBHm_Chr2g0175601
rosa_laevigata RLG00000022343
rosa_multiflora Rmu_sc0000998.1_g000022 Rmu_sc0012222.1_g000001
rosa_rugosa Rorug02G0586600
rosa_samantha Rh2CG639800
rosa_wichuraiana Rw2G054590

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 329
AccB7I CCANNNNNTGG 2 cut(s) 134, 382
AclWI GGATC 1 cut(s) 119
AcsI RAATTY 1 cut(s) 332
AcuI CTGAAG 1 cut(s) 338
AfiI CCNNNNNNNGG 3 cut(s) 134, 154, 382
AgsI TTSAA 2 cut(s) 284, 449
AjiI CACGTC 1 cut(s) 28
AjnI CCWGG 1 cut(s) 147
AjuI GAANNNNNNNTTGG 2 cut(s) 231, 263
AluBI AGCT 3 cut(s) 71, 77, 247
AluI AGCT 3 cut(s) 71, 77, 247
AlwI GGATC 1 cut(s) 119
AlwNI CAGNNNCTG 1 cut(s) 307
AoxI GGCC 1 cut(s) 228
ApeKI GCWGC 4 cut(s) 295, 298, 301, 407
ApoI RAATTY 1 cut(s) 332
AspLEI GCGC 2 cut(s) 330, 375
AsuHPI GGTGA 3 cut(s) 169, 382, 453
BbvI GCAGC 4 cut(s) 307, 310, 313, 394
BccI CCATC 2 cut(s) 41, 376
BciT130I CCWGG 1 cut(s) 149
BclI TGATCA 2 cut(s) 178, 346
BfaI CTAG 2 cut(s) 341, 362
BfmI CTRYAG 2 cut(s) 72, 354
BisI GCNGC 4 cut(s) 296, 299, 302, 408
BlsI GCNGC 4 cut(s) 297, 300, 303, 409
Bme1390I CCNGG 1 cut(s) 149
BmgBI CACGTC 1 cut(s) 28
BmrFI CCNGG 1 cut(s) 149
BmsI GCATC 4 cut(s) 264, 303, 394, 419
BpmI CTGGAG 1 cut(s) 329
BsaBI GATNNNNATC 1 cut(s) 386
BsaJI CCNNGG 2 cut(s) 128, 148
Bsc4I CCNNNNNNNGG 3 cut(s) 134, 154, 382
Bse1I ACTGG 1 cut(s) 312
Bse3DI GCAATG 1 cut(s) 210
Bse8I GATNNNNATC 1 cut(s) 386
BseBI CCWGG 1 cut(s) 149
BseDI CCNNGG 2 cut(s) 128, 148
BseGI GGATG 2 cut(s) 279, 409
BseJI GATNNNNATC 1 cut(s) 386
BseLI CCNNNNNNNGG 3 cut(s) 134, 154, 382
BseMI GCAATG 1 cut(s) 210
BseNI ACTGG 1 cut(s) 312
BseXI GCAGC 4 cut(s) 307, 310, 313, 394
BshFI GGCC 1 cut(s) 230
BslI CCNNNNNNNGG 3 cut(s) 134, 154, 382
BsnI GGCC 1 cut(s) 230
Bsp143I GATC 3 cut(s) 124, 178, 346
BspANI GGCC 1 cut(s) 230
BspMAI CTGCAG 1 cut(s) 358
BspPI GGATC 1 cut(s) 119
BsrDI GCAATG 1 cut(s) 210
BsrI ACTGG 1 cut(s) 312
BssECI CCNNGG 2 cut(s) 128, 148
BssMI GATC 3 cut(s) 124, 178, 346
BssT1I CCWWGG 1 cut(s) 128
Bst2UI CCWGG 1 cut(s) 149
Bst6I CTCTTC 2 cut(s) 93, 216
BstAPI GCANNNNNTGC 1 cut(s) 144
BstC8I GCNNGC 1 cut(s) 377
BstENI CCTNNNNNAGG 1 cut(s) 152
BstF5I GGATG 2 cut(s) 279, 409
BstHHI GCGC 2 cut(s) 330, 375
BstKTI GATC 3 cut(s) 127, 181, 349
BstMBI GATC 3 cut(s) 124, 178, 346
BstMWI GCNNNNNNNGC 2 cut(s) 144, 301
BstNI CCWGG 1 cut(s) 149
BstSCI CCNGG 1 cut(s) 147
BstSFI CTRYAG 2 cut(s) 72, 354
BstV1I GCAGC 4 cut(s) 307, 310, 313, 394
BsuRI GGCC 1 cut(s) 230
BtrI CACGTC 1 cut(s) 28
BtsCI GGATG 2 cut(s) 279, 409
BtsI GCAGTG 1 cut(s) 84
BtsIMutI CAGTG 1 cut(s) 84
Cac8I GCNNGC 1 cut(s) 377
CaiI CAGNNNCTG 1 cut(s) 307
CfoI GCGC 2 cut(s) 330, 375
CviAII CATG 2 cut(s) 144, 423
CviJI RGCY 5 cut(s) 71, 77, 230, 242, 247
CviKI_1 RGCY 5 cut(s) 71, 77, 230, 242, 247
DpnI GATC 3 cut(s) 126, 180, 348
DpnII GATC 3 cut(s) 124, 178, 346
Eam1104I CTCTTC 2 cut(s) 93, 216
EarI CTCTTC 2 cut(s) 93, 216
Eco130I CCWWGG 1 cut(s) 128
Eco57I CTGAAG 1 cut(s) 338
EcoNI CCTNNNNNAGG 1 cut(s) 152
EcoRII CCWGG 1 cut(s) 147
EcoT14I CCWWGG 1 cut(s) 128
ErhI CCWWGG 1 cut(s) 128
FaeI CATG 2 cut(s) 147, 426
FaiI YATR 7 cut(s) 140, 145, 164, 171, 188, 204, 424
FalI AAGNNNNNCTT 2 cut(s) 231, 263
FatI CATG 2 cut(s) 143, 422
FbaI TGATCA 2 cut(s) 178, 346
Fnu4HI GCNGC 4 cut(s) 296, 299, 302, 408
FokI GGATG 2 cut(s) 286, 416
Fsp4HI GCNGC 4 cut(s) 296, 299, 302, 408
FspBI CTAG 2 cut(s) 341, 362
FspI TGCGCA 1 cut(s) 329
GlaI GCGC 2 cut(s) 329, 374
GluI GCNGC 4 cut(s) 296, 299, 302, 408
GsuI CTGGAG 1 cut(s) 329
HaeIII GGCC 1 cut(s) 230
HhaI GCGC 2 cut(s) 330, 375
Hin1II CATG 2 cut(s) 147, 426
Hin6I GCGC 2 cut(s) 328, 373
HinP1I GCGC 2 cut(s) 328, 373
HinfI GANTC 3 cut(s) 193, 280, 433
HphI GGTGA 3 cut(s) 169, 382, 453
Hpy188III TCNNGA 4 cut(s) 110, 182, 284, 437
Hpy99I CGWCG 1 cut(s) 29
HpyCH4IV ACGT 1 cut(s) 27
HpyCH4V TGCA 6 cut(s) 44, 215, 277, 295, 356, 410
HpyF10VI GCNNNNNNNGC 2 cut(s) 144, 301
HpySE526I ACGT 1 cut(s) 27
Hsp92II CATG 2 cut(s) 147, 426
HspAI GCGC 2 cut(s) 328, 373
Ksp22I TGATCA 2 cut(s) 178, 346
Kzo9I GATC 3 cut(s) 124, 178, 346
LmnI GCTCC 2 cut(s) 251, 427
LpnPI CCDG 9 cut(s) 50, 95, 134, 161, 167, 244, 293, 389, 422
Lsp1109I GCAGC 4 cut(s) 307, 310, 313, 394
LweI GCATC 4 cut(s) 264, 303, 394, 419
MaeI CTAG 2 cut(s) 341, 362
MaeII ACGT 1 cut(s) 27
MaeIII GTNAC 1 cut(s) 79
MalI GATC 3 cut(s) 126, 180, 348
MboI GATC 3 cut(s) 124, 178, 346
MboII GAAGA 3 cut(s) 43, 110, 233
MluCI AATT 2 cut(s) 39, 332
MnlI CCTC 3 cut(s) 49, 394, 447
MseI TTAA 1 cut(s) 471
MspR9I CCNGG 1 cut(s) 149
MvaI CCWGG 1 cut(s) 149
MwoI GCNNNNNNNGC 2 cut(s) 144, 301
NdeII GATC 3 cut(s) 124, 178, 346
NlaIII CATG 2 cut(s) 147, 426
NmeAIII GCCGAG 1 cut(s) 268
NmuCI GTSAC 1 cut(s) 79
NsbI TGCGCA 1 cut(s) 329
PfeI GAWTC 3 cut(s) 193, 280, 433
PflMI CCANNNNNTGG 2 cut(s) 134, 382
PkrI GCNGC 4 cut(s) 297, 300, 303, 409
Psp6I CCWGG 1 cut(s) 147
PspGI CCWGG 1 cut(s) 147
PstI CTGCAG 1 cut(s) 358
PstNI CAGNNNCTG 1 cut(s) 307
SaqAI TTAA 1 cut(s) 471
SatI GCNGC 4 cut(s) 296, 299, 302, 408
Sau3AI GATC 3 cut(s) 124, 178, 346
ScrFI CCNGG 1 cut(s) 149
SetI ASST 7 cut(s) 30, 73, 79, 134, 159, 249, 466
SfaNI GCATC 4 cut(s) 264, 303, 394, 419
SfcI CTRYAG 2 cut(s) 72, 354
Sse9I AATT 2 cut(s) 39, 332
SspMI CTAG 2 cut(s) 341, 362
StyD4I CCNGG 1 cut(s) 147
StyI CCWWGG 1 cut(s) 128
TaiI ACGT 1 cut(s) 30
TasI AATT 2 cut(s) 39, 332
TfiI GAWTC 3 cut(s) 193, 280, 433
Tru1I TTAA 1 cut(s) 471
Tru9I TTAA 1 cut(s) 471
TscAI CASTG 1 cut(s) 91
TseFI GTSAC 1 cut(s) 79
TseI GCWGC 4 cut(s) 295, 298, 301, 407
Tsp45I GTSAC 1 cut(s) 79
TspDTI ATGAA 2 cut(s) 199, 252
TspRI CASTG 1 cut(s) 91
Van91I CCANNNNNTGG 2 cut(s) 134, 382
XagI CCTNNNNNAGG 1 cut(s) 152
XapI RAATTY 1 cut(s) 332
XspI CTAG 2 cut(s) 341, 362
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.