Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001144.1

Orthogroup ID

OG0019081

Physical Location & Seq

Genomic Coordinates Reverse (-)

90852 .. 91236

Gene Structure 385 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001144.1_g000022.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 306 bp

atgctcaccattggtttccaagctaccaatctcggagaagccatcgaaatcgtcaaccaaatggtcgattggaggctagtagatgaggttgtagctgaagatagtggtgaggagaagagggatggaaagtttagagagtcggtgaagtgtaaagtgtttttgggtttcacttcgaatttggtttcttctgggcttagagatgtgtttaggtgcttggtggaccgtcgcaccaatggcagtacgcggagactttctttgccaatgggccttcgaaatggctccaatcctccaacctatcatgggtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0006464 GO:0006807 GO:0007275 GO:0008150 GO:0008152 GO:0008612 GO:0009058 GO:0009553 GO:0009987 GO:0010467 GO:0016740 GO:0016765 GO:0018193 GO:0018205 GO:0019538 GO:0032501 GO:0032502 GO:0034038 GO:0036211 GO:0043170 GO:0043412 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044424 GO:0044464 GO:0048229 GO:0048856 GO:0051604 GO:0071704 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Protein Analysis

101

Amino Acids

11.29

Weight (kDa)

7.81

Isoelectric Point (pI)

35.29

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019081)

Species	Orthologous Gene IDs
rosa_laevigata	RLG00000028398
rosa_multiflora	Rmu_sc0001144.1_g000022
rosa_roxburghii	Rroxscaffold_1G00034370 Rroxscaffold_4G00303700 Rroxscaffold_6G00397550 Rroxscaffold_7G00190850
rosa_rugosa	Rorug02G0028200
rosa_samantha	Rh1AG233800 Rh1CG218400

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccII	CGCG	1 cut(s)	244
AciI	CCGC	1 cut(s)	244
AcsI	RAATTY	1 cut(s)	175
AcuI	CTGAAG	1 cut(s)	117
AfaI	GTAC	1 cut(s)	241
AfiI	CCNNNNNNNGG	1 cut(s)	300
AluBI	AGCT	2 cut(s)	23, 95
AluI	AGCT	2 cut(s)	23, 95
Alw26I	GTCTC	1 cut(s)	241
AoxI	GGCC	1 cut(s)	265
ApoI	RAATTY	1 cut(s)	175
AspS9I	GGNCC	2 cut(s)	220, 265
AsuHPI	GGTGA	2 cut(s)	119, 154
AsuII	TTCGAA	2 cut(s)	173, 271
AvaII	GGWCC	1 cut(s)	220
BccI	CCATC	2 cut(s)	50, 116
BcoDI	GTCTC	1 cut(s)	241
BfaI	CTAG	1 cut(s)	77
Bme18I	GGWCC	1 cut(s)	220
BmgT120I	GGNCC	2 cut(s)	220, 265
BmiI	GGNNCC	1 cut(s)	280
Bpu14I	TTCGAA	2 cut(s)	173, 271
Bsc4I	CCNNNNNNNGG	1 cut(s)	300
BseGI	GGATG	1 cut(s)	127
BseLI	CCNNNNNNNGG	1 cut(s)	300
BseRI	GAGGAG	1 cut(s)	125
Bsh1236I	CGCG	1 cut(s)	244
BshFI	GGCC	1 cut(s)	267
BslI	CCNNNNNNNGG	1 cut(s)	300
BsmAI	GTCTC	1 cut(s)	241
BsnI	GGCC	1 cut(s)	267
Bsp119I	TTCGAA	2 cut(s)	173, 271
BspACI	CCGC	1 cut(s)	244
BspANI	GGCC	1 cut(s)	267
BspFNI	CGCG	1 cut(s)	244
BspLI	GGNNCC	1 cut(s)	280
BspT104I	TTCGAA	2 cut(s)	173, 271
Bst4CI	ACNGT	1 cut(s)	224
Bst6I	CTCTTC	1 cut(s)	110
BstBI	TTCGAA	2 cut(s)	173, 271
BstDEI	CTNAG	1 cut(s)	194
BstF5I	GGATG	1 cut(s)	127
BstFNI	CGCG	1 cut(s)	244
BstMAI	GTCTC	1 cut(s)	241
BstMWI	GCNNNNNNNGC	1 cut(s)	234
BstUI	CGCG	1 cut(s)	244
BsuRI	GGCC	1 cut(s)	267
BtsCI	GGATG	1 cut(s)	127
Cfr13I	GGNCC	2 cut(s)	220, 265
Csp6I	GTAC	1 cut(s)	240
CviAII	CATG	1 cut(s)	299
CviJI	RGCY	7 cut(s)	23, 41, 76, 95, 193, 267, 279
CviKI_1	RGCY	7 cut(s)	23, 41, 76, 95, 193, 267, 279
CviQI	GTAC	1 cut(s)	240
DdeI	CTNAG	1 cut(s)	194
Eam1104I	CTCTTC	1 cut(s)	110
EarI	CTCTTC	1 cut(s)	110
Eco47I	GGWCC	1 cut(s)	220
Eco57I	CTGAAG	1 cut(s)	117
FaeI	CATG	1 cut(s)	302
FaiI	YATR	1 cut(s)	300
FatI	CATG	1 cut(s)	298
FokI	GGATG	1 cut(s)	134
FspBI	CTAG	1 cut(s)	77
HaeIII	GGCC	1 cut(s)	267
Hin1II	CATG	1 cut(s)	302
HincII	GTYRAC	1 cut(s)	55
HindII	GTYRAC	1 cut(s)	55
HinfI	GANTC	1 cut(s)	137
HphI	GGTGA	2 cut(s)	119, 154
Hpy166II	GTNNAC	2 cut(s)	55, 220
Hpy188I	TCNGA	1 cut(s)	35
Hpy8I	GTNNAC	2 cut(s)	55, 220
Hpy99I	CGWCG	1 cut(s)	228
HpyAV	CCTTC	1 cut(s)	278
HpyCH4III	ACNGT	1 cut(s)	224
HpyF10VI	GCNNNNNNNGC	1 cut(s)	234
HpyF3I	CTNAG	1 cut(s)	194
Hsp92II	CATG	1 cut(s)	302
LmnI	GCTCC	1 cut(s)	284
LpnPI	CCDG	1 cut(s)	174
MaeI	CTAG	1 cut(s)	77
MboII	GAAGA	3 cut(s)	110, 127, 177
MluCI	AATT	1 cut(s)	175
MlyI	GAGTC	1 cut(s)	146
MnlI	CCTC	5 cut(s)	66, 79, 103, 111, 297
MvnI	CGCG	1 cut(s)	244
MwoI	GCNNNNNNNGC	1 cut(s)	234
NlaIII	CATG	1 cut(s)	302
NlaIV	GGNNCC	1 cut(s)	280
NspV	TTCGAA	2 cut(s)	173, 271
PleI	GAGTC	1 cut(s)	145
PpsI	GAGTC	1 cut(s)	145
PspN4I	GGNNCC	1 cut(s)	280
PspPI	GGNCC	2 cut(s)	220, 265
RsaI	GTAC	1 cut(s)	241
RsaNI	GTAC	1 cut(s)	240
Sau96I	GGNCC	2 cut(s)	220, 265
SchI	GAGTC	1 cut(s)	146
SetI	ASST	5 cut(s)	25, 90, 97, 212, 296
SfuI	TTCGAA	2 cut(s)	173, 271
SgeI	CNNG	6 cut(s)	32, 44, 89, 201, 226, 255
SinI	GGWCC	1 cut(s)	220
Sse9I	AATT	1 cut(s)	175
SsiI	CCGC	1 cut(s)	244
SspMI	CTAG	1 cut(s)	77
TaaI	ACNGT	1 cut(s)	224
TaqI	TCGA	4 cut(s)	45, 66, 173, 271
TasI	AATT	1 cut(s)	175
VpaK11BI	GGWCC	1 cut(s)	220
XapI	RAATTY	1 cut(s)	175
XspI	CTAG	1 cut(s)	77

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.