Rmu_sc0001304.1_g000023

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001304.1
Physical Location & Seq
Reverse (-)
67572 .. 68167
596 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001304.1_g000023.1.cds

Sequence Viewer

Length: 234 bp
atgctgaggatagaagggaagggaaagtttgtggaggggctagtgtatgcaccacagatacctagcttgctttctgttgatcctactgtggatcctcgcaaatccctagccagtaatatttcatttggtacagaagttgaagtccaacttgggaaacgtcttacaggaaatatttgtctcctcccggcctcaattgttggacaaatgaacgactcggaaatggcaatgcaatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

77

Amino Acids

8.29

Weight (kDa)

5.18

Isoelectric Point (pI)

43.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 3 cut(s) 74, 86, 99
AfaI GTAC 1 cut(s) 130
AgsI TTSAA 1 cut(s) 140
AjuI GAANNNNNNNTTGG 2 cut(s) 132, 164
AluBI AGCT 1 cut(s) 66
AluI AGCT 1 cut(s) 66
Alw26I GTCTC 1 cut(s) 182
AlwI GGATC 3 cut(s) 74, 86, 99
AoxI GGCC 1 cut(s) 186
AsuC2I CCSGG 1 cut(s) 185
BaeI ACNNNNGTAYC 2 cut(s) 120, 153
BamHI GGATCC 1 cut(s) 91
BbvCI CCTCAGC 1 cut(s) 5
BcnI CCSGG 1 cut(s) 185
BcoDI GTCTC 1 cut(s) 182
BfaI CTAG 3 cut(s) 41, 63, 107
Bme1390I CCNGG 1 cut(s) 185
BmiI GGNNCC 1 cut(s) 93
BmrFI CCNGG 1 cut(s) 185
Bpu10I CCTNAGC 1 cut(s) 5
BpuMI CCSGG 1 cut(s) 185
Bse1I ACTGG 1 cut(s) 111
Bse3DI GCAATG 1 cut(s) 231
BseMI GCAATG 1 cut(s) 231
BseNI ACTGG 1 cut(s) 111
BseRI GAGGAG 1 cut(s) 170
BshFI GGCC 1 cut(s) 188
BsiSI CCGG 1 cut(s) 185
BsmAI GTCTC 1 cut(s) 182
BsnI GGCC 1 cut(s) 188
Bsp143I GATC 2 cut(s) 79, 91
BspANI GGCC 1 cut(s) 188
BspLI GGNNCC 1 cut(s) 93
BspPI GGATC 3 cut(s) 74, 86, 99
BsrDI GCAATG 1 cut(s) 231
BsrI ACTGG 1 cut(s) 111
BssMI GATC 2 cut(s) 79, 91
Bst4CI ACNGT 1 cut(s) 88
BstC8I GCNNGC 1 cut(s) 68
BstDEI CTNAG 1 cut(s) 5
BstKTI GATC 2 cut(s) 82, 94
BstMAI GTCTC 1 cut(s) 182
BstMBI GATC 2 cut(s) 79, 91
BstSCI CCNGG 1 cut(s) 183
BstX2I RGATCY 1 cut(s) 91
BstYI RGATCY 1 cut(s) 91
BsuRI GGCC 1 cut(s) 188
Cac8I GCNNGC 1 cut(s) 68
Csp6I GTAC 1 cut(s) 129
CviJI RGCY 4 cut(s) 40, 66, 110, 188
CviKI_1 RGCY 4 cut(s) 40, 66, 110, 188
CviQI GTAC 1 cut(s) 129
DdeI CTNAG 1 cut(s) 5
DpnI GATC 2 cut(s) 81, 93
DpnII GATC 2 cut(s) 79, 91
FaiI YATR 1 cut(s) 48
FalI AAGNNNNNCTT 2 cut(s) 132, 164
FspBI CTAG 3 cut(s) 41, 63, 107
HaeIII GGCC 1 cut(s) 188
HapII CCGG 1 cut(s) 185
HinfI GANTC 1 cut(s) 212
HpaII CCGG 1 cut(s) 185
Hpy188I TCNGA 1 cut(s) 217
HpyAV CCTTC 2 cut(s) 8, 13
HpyCH4III ACNGT 1 cut(s) 88
HpyCH4IV ACGT 1 cut(s) 157
HpyCH4V TGCA 2 cut(s) 50, 229
HpyF3I CTNAG 1 cut(s) 5
HpySE526I ACGT 1 cut(s) 157
Kzo9I GATC 2 cut(s) 79, 91
LpnPI CCDG 3 cut(s) 124, 150, 198
MaeI CTAG 3 cut(s) 41, 63, 107
MaeII ACGT 1 cut(s) 157
MalI GATC 2 cut(s) 81, 93
MboI GATC 2 cut(s) 79, 91
MfeI CAATTG 1 cut(s) 192
MflI RGATCY 1 cut(s) 91
MluCI AATT 1 cut(s) 192
MlyI GAGTC 1 cut(s) 206
MmeI TCCRAC 2 cut(s) 169, 178
MnlI CCTC 4 cut(s) 28, 105, 191, 199
MspI CCGG 1 cut(s) 185
MspR9I CCNGG 1 cut(s) 185
MunI CAATTG 1 cut(s) 192
NciI CCSGG 1 cut(s) 185
NdeII GATC 2 cut(s) 79, 91
NlaIV GGNNCC 1 cut(s) 93
PleI GAGTC 1 cut(s) 206
PpsI GAGTC 1 cut(s) 206
PspN4I GGNNCC 1 cut(s) 93
PsuI RGATCY 1 cut(s) 91
RsaI GTAC 1 cut(s) 130
RsaNI GTAC 1 cut(s) 129
Sau3AI GATC 2 cut(s) 79, 91
SchI GAGTC 1 cut(s) 206
ScrFI CCNGG 1 cut(s) 185
SetI ASST 3 cut(s) 64, 68, 160
Sse9I AATT 1 cut(s) 192
SspI AATATT 2 cut(s) 118, 172
SspMI CTAG 3 cut(s) 41, 63, 107
StyD4I CCNGG 1 cut(s) 183
TaaI ACNGT 1 cut(s) 88
TaiI ACGT 1 cut(s) 160
TasI AATT 1 cut(s) 192
TspDTI ATGAA 2 cut(s) 111, 221
XspI CTAG 3 cut(s) 41, 63, 107
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.