Rh4AG176500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
Physical Location & Seq
Forward (+)
44244266 .. 44246527
2262 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG176500.1

Sequence Viewer

Length: 312 bp
ATGCCGAGGATAGAAGGGAAGGGAAAGTTTGATCAGGCAAGGTGGAGGCTAGTGTATGCACCACAGATACATAGCTTGCTTTCTGTTGATCCTACTGTGGATCCTCTCAAATCCCTGGCCAATAATATTTTGTTGGGTACAGAAGTTGAAGTCCAACTTGGGAAACGTCTTACAGATATTTTTCAAGCAAACTCCTTAATCTGCTTTCTATATTGTTGCAACTCACATTTGATTCGACTTAATTCTTATTCTAGTTTTGCTATTTGTTATTATTTAGAATATTGTGTCGCTTTAGCAAGGGAGTTGAGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

103

Amino Acids

11.8

Weight (kDa)

8.31

Isoelectric Point (pI)

38.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 3 cut(s) 83, 95, 108
AcoI YGGCCR 1 cut(s) 117
AfaI GTAC 1 cut(s) 139
AgsI TTSAA 2 cut(s) 149, 185
AjnI CCWGG 1 cut(s) 114
AjuI GAANNNNNNNTTGG 2 cut(s) 141, 173
AluBI AGCT 1 cut(s) 75
AluI AGCT 1 cut(s) 75
AlwI GGATC 3 cut(s) 83, 95, 108
AoxI GGCC 1 cut(s) 117
BaeI ACNNNNGTAYC 2 cut(s) 129, 162
BalI TGGCCA 1 cut(s) 119
BamHI GGATCC 1 cut(s) 100
BciT130I CCWGG 1 cut(s) 116
BclI TGATCA 1 cut(s) 31
BfaI CTAG 2 cut(s) 50, 252
Bme1390I CCNGG 1 cut(s) 116
BmiI GGNNCC 1 cut(s) 102
BmrFI CCNGG 1 cut(s) 116
BsaJI CCNNGG 2 cut(s) 5, 114
BseBI CCWGG 1 cut(s) 116
BseDI CCNNGG 2 cut(s) 5, 114
BshFI GGCC 1 cut(s) 119
BsnI GGCC 1 cut(s) 119
Bsp143I GATC 3 cut(s) 31, 88, 100
BspANI GGCC 1 cut(s) 119
BspLI GGNNCC 1 cut(s) 102
BspPI GGATC 3 cut(s) 83, 95, 108
BssECI CCNNGG 2 cut(s) 5, 114
BssMI GATC 3 cut(s) 31, 88, 100
Bst2UI CCWGG 1 cut(s) 116
Bst4CI ACNGT 1 cut(s) 97
BstC8I GCNNGC 1 cut(s) 77
BstKTI GATC 3 cut(s) 34, 91, 103
BstMBI GATC 3 cut(s) 31, 88, 100
BstNI CCWGG 1 cut(s) 116
BstSCI CCNGG 1 cut(s) 114
BstX2I RGATCY 1 cut(s) 100
BstYI RGATCY 1 cut(s) 100
BsuRI GGCC 1 cut(s) 119
Cac8I GCNNGC 1 cut(s) 77
Csp6I GTAC 1 cut(s) 138
CviJI RGCY 3 cut(s) 49, 75, 119
CviKI_1 RGCY 3 cut(s) 49, 75, 119
CviQI GTAC 1 cut(s) 138
DpnI GATC 3 cut(s) 33, 90, 102
DpnII GATC 3 cut(s) 31, 88, 100
EaeI YGGCCR 1 cut(s) 117
EcoRII CCWGG 1 cut(s) 114
FaiI YATR 3 cut(s) 57, 72, 211
FalI AAGNNNNNCTT 2 cut(s) 141, 173
FbaI TGATCA 1 cut(s) 31
FspBI CTAG 2 cut(s) 50, 252
HaeIII GGCC 1 cut(s) 119
HinfI GANTC 1 cut(s) 232
HpyAV CCTTC 2 cut(s) 8, 13
HpyCH4III ACNGT 1 cut(s) 97
HpyCH4IV ACGT 1 cut(s) 166
HpyCH4V TGCA 2 cut(s) 59, 219
HpySE526I ACGT 1 cut(s) 166
Ksp22I TGATCA 1 cut(s) 31
Kzo9I GATC 3 cut(s) 31, 88, 100
LpnPI CCDG 3 cut(s) 20, 101, 128
MaeI CTAG 2 cut(s) 50, 252
MaeII ACGT 1 cut(s) 166
MalI GATC 3 cut(s) 33, 90, 102
MboI GATC 3 cut(s) 31, 88, 100
MflI RGATCY 1 cut(s) 100
MlsI TGGCCA 1 cut(s) 119
MluCI AATT 1 cut(s) 241
MluNI TGGCCA 1 cut(s) 119
MmeI TCCRAC 1 cut(s) 178
MnlI CCTC 2 cut(s) 39, 114
Mox20I TGGCCA 1 cut(s) 119
MscI TGGCCA 1 cut(s) 119
MseI TTAA 2 cut(s) 197, 240
Msp20I TGGCCA 1 cut(s) 119
MspR9I CCNGG 1 cut(s) 116
MvaI CCWGG 1 cut(s) 116
NdeII GATC 3 cut(s) 31, 88, 100
NlaIV GGNNCC 1 cut(s) 102
NmeAIII GCCGAG 1 cut(s) 30
PfeI GAWTC 1 cut(s) 232
Psp6I CCWGG 1 cut(s) 114
PspGI CCWGG 1 cut(s) 114
PspN4I GGNNCC 1 cut(s) 102
PsuI RGATCY 1 cut(s) 100
RsaI GTAC 1 cut(s) 139
RsaNI GTAC 1 cut(s) 138
SaqAI TTAA 2 cut(s) 197, 240
Sau3AI GATC 3 cut(s) 31, 88, 100
ScrFI CCNGG 1 cut(s) 116
SetI ASST 3 cut(s) 44, 77, 169
Sse9I AATT 1 cut(s) 241
SspI AATATT 2 cut(s) 127, 281
SspMI CTAG 2 cut(s) 50, 252
StyD4I CCNGG 1 cut(s) 114
TaaI ACNGT 1 cut(s) 97
TaiI ACGT 1 cut(s) 169
TaqI TCGA 1 cut(s) 235
TasI AATT 1 cut(s) 241
TfiI GAWTC 1 cut(s) 232
Tru1I TTAA 2 cut(s) 197, 240
Tru9I TTAA 2 cut(s) 197, 240
XspI CTAG 2 cut(s) 50, 252
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.