Rh2DG415100

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
Physical Location & Seq
Forward (+)
60340913 .. 60341231
319 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG415100.1

Sequence Viewer

Length: 319 bp
ATGTCGAGGATAGAAGGGAAGGGAAAGTTTGATCAGGCAAGGTGGAGGCTAGTGTATGCACCACAGATACCTTGCTTGCTTTATGTTGATCCTACTGTGGATCCTCTCAAATCCCTGGCCAGTAATATTTCATTTGGTACAGAAGTTGAAGTCCAACTTGGGAAACGTCTTACATGTATTTTTCAAGCAAACTCCTTAATCACACCACAGATACCTTGCTTGCTTTATGTTGATCCTACTGTGGATCCTCTCAAATCCCTGGCCAGTAATATTTCATTTGGTACAGAAGTTGAAGTCCAACTTGTGAAACGTCTTACAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

106

Amino Acids

11.79

Weight (kDa)

7.68

Isoelectric Point (pI)

40.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 6 cut(s) 83, 95, 108, 227, 239, 252
AcoI YGGCCR 2 cut(s) 117, 261
AfaI GTAC 2 cut(s) 139, 283
AflIII ACRYGT 1 cut(s) 173
AgsI TTSAA 3 cut(s) 149, 185, 293
AjnI CCWGG 2 cut(s) 114, 258
AjuI GAANNNNNNNTTGG 2 cut(s) 141, 173
AlwI GGATC 6 cut(s) 83, 95, 108, 227, 239, 252
AoxI GGCC 2 cut(s) 117, 261
BaeI ACNNNNGTAYC 4 cut(s) 129, 162, 273, 306
BalI TGGCCA 2 cut(s) 119, 263
BamHI GGATCC 2 cut(s) 100, 244
BciT130I CCWGG 2 cut(s) 116, 260
BclI TGATCA 1 cut(s) 31
BfaI CTAG 1 cut(s) 50
Bme1390I CCNGG 2 cut(s) 116, 260
BmiI GGNNCC 2 cut(s) 102, 246
BmrFI CCNGG 2 cut(s) 116, 260
BsaJI CCNNGG 2 cut(s) 114, 258
Bse1I ACTGG 2 cut(s) 120, 264
BseBI CCWGG 2 cut(s) 116, 260
BseDI CCNNGG 2 cut(s) 114, 258
BseNI ACTGG 2 cut(s) 120, 264
BshFI GGCC 2 cut(s) 119, 263
BsnI GGCC 2 cut(s) 119, 263
Bsp143I GATC 5 cut(s) 31, 88, 100, 232, 244
BspANI GGCC 2 cut(s) 119, 263
BspLI GGNNCC 2 cut(s) 102, 246
BspPI GGATC 6 cut(s) 83, 95, 108, 227, 239, 252
BsrI ACTGG 2 cut(s) 120, 264
BssECI CCNNGG 2 cut(s) 114, 258
BssMI GATC 5 cut(s) 31, 88, 100, 232, 244
Bst2UI CCWGG 2 cut(s) 116, 260
Bst4CI ACNGT 2 cut(s) 97, 241
BstC8I GCNNGC 2 cut(s) 77, 221
BstKTI GATC 5 cut(s) 34, 91, 103, 235, 247
BstMBI GATC 5 cut(s) 31, 88, 100, 232, 244
BstNI CCWGG 2 cut(s) 116, 260
BstNSI RCATGY 1 cut(s) 177
BstSCI CCNGG 2 cut(s) 114, 258
BstX2I RGATCY 2 cut(s) 100, 244
BstYI RGATCY 2 cut(s) 100, 244
BsuRI GGCC 2 cut(s) 119, 263
Cac8I GCNNGC 2 cut(s) 77, 221
Csp6I GTAC 2 cut(s) 138, 282
CviAII CATG 1 cut(s) 174
CviJI RGCY 3 cut(s) 49, 119, 263
CviKI_1 RGCY 3 cut(s) 49, 119, 263
CviQI GTAC 2 cut(s) 138, 282
DpnI GATC 5 cut(s) 33, 90, 102, 234, 246
DpnII GATC 5 cut(s) 31, 88, 100, 232, 244
EaeI YGGCCR 2 cut(s) 117, 261
EcoRII CCWGG 2 cut(s) 114, 258
FaeI CATG 1 cut(s) 177
FaiI YATR 4 cut(s) 57, 84, 175, 228
FalI AAGNNNNNCTT 4 cut(s) 141, 173, 285, 317
FatI CATG 1 cut(s) 173
FbaI TGATCA 1 cut(s) 31
FspBI CTAG 1 cut(s) 50
HaeIII GGCC 2 cut(s) 119, 263
Hin1II CATG 1 cut(s) 177
HpyAV CCTTC 2 cut(s) 8, 13
HpyCH4III ACNGT 2 cut(s) 97, 241
HpyCH4IV ACGT 2 cut(s) 166, 310
HpyCH4V TGCA 1 cut(s) 59
HpySE526I ACGT 2 cut(s) 166, 310
Hsp92II CATG 1 cut(s) 177
Ksp22I TGATCA 1 cut(s) 31
Kzo9I GATC 5 cut(s) 31, 88, 100, 232, 244
LpnPI CCDG 7 cut(s) 20, 101, 128, 133, 245, 272, 277
MaeI CTAG 1 cut(s) 50
MaeII ACGT 2 cut(s) 166, 310
MalI GATC 5 cut(s) 33, 90, 102, 234, 246
MboI GATC 5 cut(s) 31, 88, 100, 232, 244
MflI RGATCY 2 cut(s) 100, 244
MlsI TGGCCA 2 cut(s) 119, 263
MluNI TGGCCA 2 cut(s) 119, 263
MmeI TCCRAC 1 cut(s) 178
MnlI CCTC 3 cut(s) 39, 114, 258
Mox20I TGGCCA 2 cut(s) 119, 263
MscI TGGCCA 2 cut(s) 119, 263
MseI TTAA 1 cut(s) 197
Msp20I TGGCCA 2 cut(s) 119, 263
MspR9I CCNGG 2 cut(s) 116, 260
MvaI CCWGG 2 cut(s) 116, 260
NdeII GATC 5 cut(s) 31, 88, 100, 232, 244
NlaIII CATG 1 cut(s) 177
NlaIV GGNNCC 2 cut(s) 102, 246
NspI RCATGY 1 cut(s) 177
PciI ACATGT 1 cut(s) 173
PscI ACATGT 1 cut(s) 173
Psp6I CCWGG 2 cut(s) 114, 258
PspGI CCWGG 2 cut(s) 114, 258
PspN4I GGNNCC 2 cut(s) 102, 246
PsuI RGATCY 2 cut(s) 100, 244
RsaI GTAC 2 cut(s) 139, 283
RsaNI GTAC 2 cut(s) 138, 282
SaqAI TTAA 1 cut(s) 197
Sau3AI GATC 5 cut(s) 31, 88, 100, 232, 244
ScrFI CCNGG 2 cut(s) 116, 260
SetI ASST 5 cut(s) 44, 73, 169, 217, 313
SspI AATATT 2 cut(s) 127, 271
SspMI CTAG 1 cut(s) 50
StyD4I CCNGG 2 cut(s) 114, 258
TaaI ACNGT 2 cut(s) 97, 241
TaiI ACGT 2 cut(s) 169, 313
TaqI TCGA 1 cut(s) 5
Tru1I TTAA 1 cut(s) 197
Tru9I TTAA 1 cut(s) 197
TspDTI ATGAA 2 cut(s) 120, 264
XceI RCATGY 1 cut(s) 177
XspI CTAG 1 cut(s) 50
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.