Rh4BG151700

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
Physical Location & Seq
Forward (+)
27169579 .. 27183931
14353 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG151700.1

Sequence Viewer

Length: 258 bp
ATGCCGAGGATGGAAGGGAAGGGAAAGTTTGATCAGGCAAGGTGGAGGCTAGTGTATGCACCACAGATACCTAGCTTGCTTTCTGTTGATCCTACTGTGGATCCTCTCAAATCCCTGGCCAGTAATATTTCATTTGATACAGAAGTTGAAGTCCAACTTGGGAAATGTCTTACAGGTTTATTGAAAAAGACACCATCTTTAAGTCATGAGCACAAAGCAAGGAGCTTCAATAAAGATTCAAACCAAGAACTCCACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

85

Amino Acids

9.56

Weight (kDa)

8.85

Isoelectric Point (pI)

45.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 3 cut(s) 83, 95, 108
AcoI YGGCCR 1 cut(s) 117
AgsI TTSAA 4 cut(s) 149, 184, 229, 240
AjnI CCWGG 1 cut(s) 114
AjuI GAANNNNNNNTTGG 2 cut(s) 141, 173
AluBI AGCT 2 cut(s) 75, 225
AluI AGCT 2 cut(s) 75, 225
Alw21I GWGCWC 1 cut(s) 213
AlwI GGATC 3 cut(s) 83, 95, 108
AoxI GGCC 1 cut(s) 117
BaeI ACNNNNGTAYC 2 cut(s) 129, 162
BalI TGGCCA 1 cut(s) 119
BamHI GGATCC 1 cut(s) 100
Bbv12I GWGCWC 1 cut(s) 213
BccI CCATC 2 cut(s) 4, 202
BciT130I CCWGG 1 cut(s) 116
BclI TGATCA 1 cut(s) 31
BfaI CTAG 2 cut(s) 50, 72
Bme1390I CCNGG 1 cut(s) 116
BmiI GGNNCC 1 cut(s) 102
BmrFI CCNGG 1 cut(s) 116
BsaJI CCNNGG 2 cut(s) 5, 114
Bse1I ACTGG 1 cut(s) 120
BseBI CCWGG 1 cut(s) 116
BseDI CCNNGG 2 cut(s) 5, 114
BseGI GGATG 1 cut(s) 15
BseNI ACTGG 1 cut(s) 120
BshFI GGCC 1 cut(s) 119
BsiHKAI GWGCWC 1 cut(s) 213
BsnI GGCC 1 cut(s) 119
Bsp1286I GDGCHC 1 cut(s) 213
Bsp143I GATC 3 cut(s) 31, 88, 100
BspANI GGCC 1 cut(s) 119
BspHI TCATGA 1 cut(s) 205
BspLI GGNNCC 1 cut(s) 102
BspPI GGATC 3 cut(s) 83, 95, 108
BsrI ACTGG 1 cut(s) 120
BssECI CCNNGG 2 cut(s) 5, 114
BssMI GATC 3 cut(s) 31, 88, 100
Bst2UI CCWGG 1 cut(s) 116
Bst4CI ACNGT 1 cut(s) 97
BstC8I GCNNGC 1 cut(s) 77
BstF5I GGATG 1 cut(s) 15
BstKTI GATC 3 cut(s) 34, 91, 103
BstMBI GATC 3 cut(s) 31, 88, 100
BstNI CCWGG 1 cut(s) 116
BstSCI CCNGG 1 cut(s) 114
BstX2I RGATCY 1 cut(s) 100
BstYI RGATCY 1 cut(s) 100
BsuRI GGCC 1 cut(s) 119
BtsCI GGATG 1 cut(s) 15
Cac8I GCNNGC 1 cut(s) 77
CciI TCATGA 1 cut(s) 205
CviAII CATG 1 cut(s) 206
CviJI RGCY 4 cut(s) 49, 75, 119, 225
CviKI_1 RGCY 4 cut(s) 49, 75, 119, 225
DpnI GATC 3 cut(s) 33, 90, 102
DpnII GATC 3 cut(s) 31, 88, 100
EaeI YGGCCR 1 cut(s) 117
EcoRII CCWGG 1 cut(s) 114
FaeI CATG 1 cut(s) 209
FaiI YATR 2 cut(s) 57, 207
FalI AAGNNNNNCTT 2 cut(s) 141, 173
FatI CATG 1 cut(s) 205
FbaI TGATCA 1 cut(s) 31
FokI GGATG 1 cut(s) 22
FspBI CTAG 2 cut(s) 50, 72
HaeIII GGCC 1 cut(s) 119
Hin1II CATG 1 cut(s) 209
HinfI GANTC 1 cut(s) 236
Hpy188III TCNNGA 1 cut(s) 206
HpyAV CCTTC 2 cut(s) 8, 13
HpyCH4III ACNGT 1 cut(s) 97
HpyCH4V TGCA 1 cut(s) 59
Hsp92II CATG 1 cut(s) 209
Ksp22I TGATCA 1 cut(s) 31
Kzo9I GATC 3 cut(s) 31, 88, 100
LmnI GCTCC 1 cut(s) 222
LpnPI CCDG 5 cut(s) 20, 101, 128, 133, 159
MaeI CTAG 2 cut(s) 50, 72
MalI GATC 3 cut(s) 33, 90, 102
MboI GATC 3 cut(s) 31, 88, 100
MflI RGATCY 1 cut(s) 100
MhlI GDGCHC 1 cut(s) 213
MlsI TGGCCA 1 cut(s) 119
MluNI TGGCCA 1 cut(s) 119
MmeI TCCRAC 1 cut(s) 178
MnlI CCTC 2 cut(s) 39, 114
Mox20I TGGCCA 1 cut(s) 119
MscI TGGCCA 1 cut(s) 119
MseI TTAA 1 cut(s) 200
Msp20I TGGCCA 1 cut(s) 119
MspR9I CCNGG 1 cut(s) 116
MvaI CCWGG 1 cut(s) 116
NdeII GATC 3 cut(s) 31, 88, 100
NlaIII CATG 1 cut(s) 209
NlaIV GGNNCC 1 cut(s) 102
NmeAIII GCCGAG 1 cut(s) 30
PagI TCATGA 1 cut(s) 205
PfeI GAWTC 1 cut(s) 236
Psp6I CCWGG 1 cut(s) 114
PspGI CCWGG 1 cut(s) 114
PspN4I GGNNCC 1 cut(s) 102
PsuI RGATCY 1 cut(s) 100
SaqAI TTAA 1 cut(s) 200
Sau3AI GATC 3 cut(s) 31, 88, 100
ScrFI CCNGG 1 cut(s) 116
SduI GDGCHC 1 cut(s) 213
SetI ASST 5 cut(s) 44, 73, 77, 178, 227
SspI AATATT 1 cut(s) 127
SspMI CTAG 2 cut(s) 50, 72
StyD4I CCNGG 1 cut(s) 114
TaaI ACNGT 1 cut(s) 97
TfiI GAWTC 1 cut(s) 236
Tru1I TTAA 1 cut(s) 200
Tru9I TTAA 1 cut(s) 200
TspDTI ATGAA 1 cut(s) 120
XspI CTAG 2 cut(s) 50, 72
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.