Rmu_sc0022280.1_g000002

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0022280.1
Physical Location & Seq
Forward (+)
14987 .. 15590
604 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0022280.1_g000002.1.cds

Sequence Viewer

Length: 243 bp
atgtcgaggatagaagggaagggaaagtttgatcaggcaaggtggaggctagtgtatgcaccacagatacctagcttgctttttgttgctcctactgtggatcctctcaaatccctggccagtaatatttcatttggtacagaagttgaagtccaacttgggaaacgtcttacaggagatatttgtctcctcccgacctcactggttcgacaaatgaaggactcggaaatggcaatgcaatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

80

Amino Acids

8.91

Weight (kDa)

8.98

Isoelectric Point (pI)

58.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 95, 108
AcoI YGGCCR 1 cut(s) 117
AfaI GTAC 1 cut(s) 139
AgsI TTSAA 1 cut(s) 149
AjnI CCWGG 1 cut(s) 114
AjuI GAANNNNNNNTTGG 2 cut(s) 141, 173
AluBI AGCT 1 cut(s) 75
AluI AGCT 1 cut(s) 75
Alw26I GTCTC 1 cut(s) 191
AlwI GGATC 2 cut(s) 95, 108
AoxI GGCC 1 cut(s) 117
BaeI ACNNNNGTAYC 2 cut(s) 129, 162
BalI TGGCCA 1 cut(s) 119
BamHI GGATCC 1 cut(s) 100
BciT130I CCWGG 1 cut(s) 116
BclI TGATCA 1 cut(s) 31
BcoDI GTCTC 1 cut(s) 191
BfaI CTAG 2 cut(s) 50, 72
Bme1390I CCNGG 1 cut(s) 116
BmiI GGNNCC 1 cut(s) 102
BmrFI CCNGG 1 cut(s) 116
BsaJI CCNNGG 1 cut(s) 114
Bse1I ACTGG 2 cut(s) 120, 207
Bse3DI GCAATG 1 cut(s) 240
BseBI CCWGG 1 cut(s) 116
BseDI CCNNGG 1 cut(s) 114
BseMI GCAATG 1 cut(s) 240
BseNI ACTGG 2 cut(s) 120, 207
BseRI GAGGAG 1 cut(s) 179
BshFI GGCC 1 cut(s) 119
BsmAI GTCTC 1 cut(s) 191
BsnI GGCC 1 cut(s) 119
Bsp143I GATC 2 cut(s) 31, 100
BspANI GGCC 1 cut(s) 119
BspLI GGNNCC 1 cut(s) 102
BspPI GGATC 2 cut(s) 95, 108
BsrDI GCAATG 1 cut(s) 240
BsrI ACTGG 2 cut(s) 120, 207
BssECI CCNNGG 1 cut(s) 114
BssMI GATC 2 cut(s) 31, 100
Bst2UI CCWGG 1 cut(s) 116
Bst4CI ACNGT 1 cut(s) 97
BstC8I GCNNGC 1 cut(s) 77
BstKTI GATC 2 cut(s) 34, 103
BstMAI GTCTC 1 cut(s) 191
BstMBI GATC 2 cut(s) 31, 100
BstNI CCWGG 1 cut(s) 116
BstSCI CCNGG 1 cut(s) 114
BstX2I RGATCY 1 cut(s) 100
BstYI RGATCY 1 cut(s) 100
BsuRI GGCC 1 cut(s) 119
BtsIMutI CAGTG 1 cut(s) 200
Cac8I GCNNGC 1 cut(s) 77
Csp6I GTAC 1 cut(s) 138
CviJI RGCY 3 cut(s) 49, 75, 119
CviKI_1 RGCY 3 cut(s) 49, 75, 119
CviQI GTAC 1 cut(s) 138
DpnI GATC 2 cut(s) 33, 102
DpnII GATC 2 cut(s) 31, 100
EaeI YGGCCR 1 cut(s) 117
EcoRII CCWGG 1 cut(s) 114
FaiI YATR 1 cut(s) 57
FalI AAGNNNNNCTT 2 cut(s) 141, 173
FbaI TGATCA 1 cut(s) 31
FspBI CTAG 2 cut(s) 50, 72
HaeIII GGCC 1 cut(s) 119
HinfI GANTC 1 cut(s) 221
Hpy188I TCNGA 1 cut(s) 226
Hpy188III TCNNGA 1 cut(s) 193
HpyAV CCTTC 3 cut(s) 8, 13, 211
HpyCH4III ACNGT 1 cut(s) 97
HpyCH4IV ACGT 1 cut(s) 166
HpyCH4V TGCA 2 cut(s) 59, 238
HpySE526I ACGT 1 cut(s) 166
Ksp22I TGATCA 1 cut(s) 31
Kzo9I GATC 2 cut(s) 31, 100
LmnI GCTCC 1 cut(s) 94
LpnPI CCDG 6 cut(s) 20, 101, 128, 133, 159, 188
MaeI CTAG 2 cut(s) 50, 72
MaeII ACGT 1 cut(s) 166
MalI GATC 2 cut(s) 33, 102
MboI GATC 2 cut(s) 31, 100
MflI RGATCY 1 cut(s) 100
MlsI TGGCCA 1 cut(s) 119
MluNI TGGCCA 1 cut(s) 119
MlyI GAGTC 1 cut(s) 215
MmeI TCCRAC 1 cut(s) 178
MnlI CCTC 4 cut(s) 39, 114, 200, 208
Mox20I TGGCCA 1 cut(s) 119
MscI TGGCCA 1 cut(s) 119
Msp20I TGGCCA 1 cut(s) 119
MspR9I CCNGG 1 cut(s) 116
MvaI CCWGG 1 cut(s) 116
NdeII GATC 2 cut(s) 31, 100
NlaIV GGNNCC 1 cut(s) 102
PleI GAGTC 1 cut(s) 215
PpsI GAGTC 1 cut(s) 215
Psp6I CCWGG 1 cut(s) 114
PspGI CCWGG 1 cut(s) 114
PspN4I GGNNCC 1 cut(s) 102
PsuI RGATCY 1 cut(s) 100
RsaI GTAC 1 cut(s) 139
RsaNI GTAC 1 cut(s) 138
Sau3AI GATC 2 cut(s) 31, 100
SchI GAGTC 1 cut(s) 215
ScrFI CCNGG 1 cut(s) 116
SetI ASST 5 cut(s) 44, 73, 77, 169, 200
SspI AATATT 1 cut(s) 127
SspMI CTAG 2 cut(s) 50, 72
StyD4I CCNGG 1 cut(s) 114
TaaI ACNGT 1 cut(s) 97
TaiI ACGT 1 cut(s) 169
TaqI TCGA 2 cut(s) 5, 208
TscAI CASTG 1 cut(s) 207
TspDTI ATGAA 2 cut(s) 120, 230
TspRI CASTG 1 cut(s) 207
XspI CTAG 2 cut(s) 50, 72
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.