Rmu_sc0001349.1_g000005

disease resistance

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001349.1
Physical Location & Seq
Forward (+)
34345 .. 34848
504 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001349.1_g000005.1.cds

Sequence Viewer

Length: 504 bp
atgggcggctctggaaaaaccactcttgcaaaacaggtttttcttcagaatgaagttaagggccattttgattgttttgcttgggtttgcatatctcaacaatgggaaggaaaggatgtattggaagagattttaattaaactcactcccccagcaacagatagaaggaaagaaatttccaaaatgaaaaaggatgaaatagcaagggaggtctatagtatccaaagagaaaagagatgtctggtggtccttgatgacatatggactcaagaggcttggaattcaataaaagctggattcccaatcaatgaggaaacagaaagccggatattactcacttctcggaagaaagaagtcgccttgcttgcatccagaaatgactatctccaccagcctcaacctctaactgacatgcaaagctgggaactgtttgaaaagatagccatctgtggaagcgacaaaacaagtattatttttcatccaactaatactgtgcttttctag

Protein Analysis

167

Amino Acids

19.26

Weight (kDa)

6.32

Isoelectric Point (pI)

43.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 6
AcsI RAATTY 2 cut(s) 174, 280
AcuI CTGAAG 1 cut(s) 29
AgsI TTSAA 2 cut(s) 285, 434
AluBI AGCT 2 cut(s) 293, 420
AluI AGCT 2 cut(s) 293, 420
AoxI GGCC 1 cut(s) 61
ApoI RAATTY 2 cut(s) 174, 280
AspS9I GGNCC 2 cut(s) 61, 247
AvaII GGWCC 1 cut(s) 247
BccI CCATC 1 cut(s) 452
BciVI GTATCC 1 cut(s) 230
BfaI CTAG 1 cut(s) 502
BfmI CTRYAG 1 cut(s) 214
BfuI GTATCC 1 cut(s) 230
BisI GCNGC 1 cut(s) 7
BlsI GCNGC 1 cut(s) 8
Bme18I GGWCC 1 cut(s) 247
BmgT120I GGNCC 2 cut(s) 61, 247
BmsI GCATC 1 cut(s) 377
BpuEI CTTGAG 1 cut(s) 252
BsaBI GATNNNNATC 1 cut(s) 443
Bse8I GATNNNNATC 1 cut(s) 443
BseGI GGATG 4 cut(s) 121, 199, 368, 478
BseJI GATNNNNATC 1 cut(s) 443
BseYI CCCAGC 2 cut(s) 151, 420
BshFI GGCC 1 cut(s) 63
BsiSI CCGG 1 cut(s) 325
BsnI GGCC 1 cut(s) 63
BspACI CCGC 1 cut(s) 6
BspANI GGCC 1 cut(s) 63
Bst4CI ACNGT 2 cut(s) 429, 493
Bst6I CTCTTC 1 cut(s) 120
BstC8I GCNNGC 1 cut(s) 366
BstF5I GGATG 4 cut(s) 121, 199, 368, 478
BstMWI GCNNNNNNNGC 1 cut(s) 365
BstNSI RCATGY 1 cut(s) 415
BstSFI CTRYAG 1 cut(s) 214
BsuI GTATCC 1 cut(s) 230
BsuRI GGCC 1 cut(s) 63
BtsCI GGATG 4 cut(s) 121, 199, 368, 478
Cac8I GCNNGC 1 cut(s) 366
Cfr13I GGNCC 2 cut(s) 61, 247
CviAII CATG 1 cut(s) 412
CviJI RGCY 8 cut(s) 9, 63, 275, 293, 324, 394, 420, 443
CviKI_1 RGCY 8 cut(s) 9, 63, 275, 293, 324, 394, 420, 443
Eam1104I CTCTTC 1 cut(s) 120
EarI CTCTTC 1 cut(s) 120
Eco47I GGWCC 1 cut(s) 247
Eco57I CTGAAG 1 cut(s) 29
EcoRI GAATTC 1 cut(s) 280
FaeI CATG 1 cut(s) 415
FaiI YATR 5 cut(s) 92, 216, 260, 262, 413
FatI CATG 1 cut(s) 411
FauNDI CATATG 1 cut(s) 260
Fnu4HI GCNGC 1 cut(s) 7
FokI GGATG 4 cut(s) 128, 206, 355, 465
Fsp4HI GCNGC 1 cut(s) 7
FspBI CTAG 1 cut(s) 502
GluI GCNGC 1 cut(s) 7
GsaI CCCAGC 2 cut(s) 155, 424
HaeIII GGCC 1 cut(s) 63
HapII CCGG 1 cut(s) 325
Hin1II CATG 1 cut(s) 415
HinfI GANTC 2 cut(s) 265, 297
HpaII CCGG 1 cut(s) 325
Hpy188I TCNGA 2 cut(s) 48, 345
Hpy188III TCNNGA 3 cut(s) 12, 269, 372
HpyAV CCTTC 2 cut(s) 101, 159
HpyCH4III ACNGT 2 cut(s) 429, 493
HpyCH4V TGCA 4 cut(s) 29, 90, 368, 415
HpyF10VI GCNNNNNNNGC 1 cut(s) 365
Hsp92II CATG 1 cut(s) 415
LpnPI CCDG 8 cut(s) 20, 165, 227, 279, 338, 385, 404, 406
LweI GCATC 1 cut(s) 377
MaeI CTAG 1 cut(s) 502
MboII GAAGA 3 cut(s) 35, 137, 358
MluCI AATT 3 cut(s) 135, 174, 280
MlyI GAGTC 1 cut(s) 259
MnlI CCTC 5 cut(s) 202, 265, 304, 405, 411
MseI TTAA 3 cut(s) 57, 134, 138
MspI CCGG 1 cut(s) 325
MwoI GCNNNNNNNGC 1 cut(s) 365
NdeI CATATG 1 cut(s) 260
NlaIII CATG 1 cut(s) 415
NspI RCATGY 1 cut(s) 415
PacI TTAATTAA 1 cut(s) 138
PfeI GAWTC 1 cut(s) 297
PkrI GCNGC 1 cut(s) 8
PleI GAGTC 1 cut(s) 259
PpsI GAGTC 1 cut(s) 259
PspFI CCCAGC 2 cut(s) 151, 420
PspPI GGNCC 2 cut(s) 61, 247
SaqAI TTAA 3 cut(s) 57, 134, 138
SatI GCNGC 1 cut(s) 7
Sau96I GGNCC 2 cut(s) 61, 247
SchI GAGTC 1 cut(s) 259
SetI ASST 5 cut(s) 39, 213, 295, 403, 422
SfaNI GCATC 1 cut(s) 377
SfcI CTRYAG 1 cut(s) 214
SinI GGWCC 1 cut(s) 247
SmlI CTYRAG 1 cut(s) 267
SmoI CTYRAG 1 cut(s) 267
Sse9I AATT 3 cut(s) 135, 174, 280
SsiI CCGC 1 cut(s) 6
SspMI CTAG 1 cut(s) 502
TaaI ACNGT 2 cut(s) 429, 493
TasI AATT 3 cut(s) 135, 174, 280
TauI GCSGC 1 cut(s) 9
TfiI GAWTC 1 cut(s) 297
Tru1I TTAA 3 cut(s) 57, 134, 138
Tru9I TTAA 3 cut(s) 57, 134, 138
TspDTI ATGAA 4 cut(s) 66, 200, 210, 467
VpaK11BI GGWCC 1 cut(s) 247
XapI RAATTY 2 cut(s) 174, 280
XceI RCATGY 1 cut(s) 415
XspI CTAG 1 cut(s) 502
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.