Rmu_sc0003762.1_g000016

disease resistance

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003762.1
Physical Location & Seq
Reverse (-)
62158 .. 62445
288 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003762.1_g000016.1.cds

Sequence Viewer

Length: 288 bp
atgaaaaaggatgaaatagcaagggaggtatgtagtatccaacgagaaaagagatatctggtggtccttgatgacatatggactcaagaggcttggaattcgataaaagctggattcccaatcaatgaggaaacagagagccggatattactcactactcgcaagaaagaagtcgccttgcttgcatccagaaatgactatctccaccagcctcaacctctaaatgatatgcaaagtgttggaggccgcacttgtaatgccacaagcaaccttgtccagggtcattag

Protein Analysis

95

Amino Acids

10.9

Weight (kDa)

6.72

Isoelectric Point (pI)

41.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 247
AcsI RAATTY 1 cut(s) 97
AfiI CCNNNNNNNGG 1 cut(s) 277
AjnI CCWGG 1 cut(s) 276
AluBI AGCT 1 cut(s) 110
AluI AGCT 1 cut(s) 110
AoxI GGCC 1 cut(s) 244
ApoI RAATTY 1 cut(s) 97
AspS9I GGNCC 1 cut(s) 64
AvaII GGWCC 1 cut(s) 64
BciT130I CCWGG 1 cut(s) 278
BciVI GTATCC 1 cut(s) 47
BfuI GTATCC 1 cut(s) 47
BisI GCNGC 1 cut(s) 247
BlsI GCNGC 1 cut(s) 248
Bme1390I CCNGG 1 cut(s) 278
Bme18I GGWCC 1 cut(s) 64
BmgT120I GGNCC 1 cut(s) 64
BmrFI CCNGG 1 cut(s) 278
BmsI GCATC 1 cut(s) 194
BpuEI CTTGAG 1 cut(s) 69
BsaJI CCNNGG 1 cut(s) 277
Bsc4I CCNNNNNNNGG 1 cut(s) 277
BseBI CCWGG 1 cut(s) 278
BseDI CCNNGG 1 cut(s) 277
BseGI GGATG 2 cut(s) 16, 185
BseLI CCNNNNNNNGG 1 cut(s) 277
BshFI GGCC 1 cut(s) 246
BsiSI CCGG 1 cut(s) 142
BslI CCNNNNNNNGG 1 cut(s) 277
BsnI GGCC 1 cut(s) 246
BspACI CCGC 1 cut(s) 247
BspANI GGCC 1 cut(s) 246
BssECI CCNNGG 1 cut(s) 277
Bst2UI CCWGG 1 cut(s) 278
BstC8I GCNNGC 1 cut(s) 183
BstENI CCTNNNNNAGG 1 cut(s) 275
BstF5I GGATG 2 cut(s) 16, 185
BstMWI GCNNNNNNNGC 1 cut(s) 182
BstNI CCWGG 1 cut(s) 278
BstSCI CCNGG 1 cut(s) 276
BsuI GTATCC 1 cut(s) 47
BsuRI GGCC 1 cut(s) 246
BtsCI GGATG 2 cut(s) 16, 185
Cac8I GCNNGC 1 cut(s) 183
Cfr13I GGNCC 1 cut(s) 64
CviJI RGCY 5 cut(s) 92, 110, 141, 211, 246
CviKI_1 RGCY 5 cut(s) 92, 110, 141, 211, 246
Eco32I GATATC 1 cut(s) 56
Eco47I GGWCC 1 cut(s) 64
EcoNI CCTNNNNNAGG 1 cut(s) 275
EcoRI GAATTC 1 cut(s) 97
EcoRII CCWGG 1 cut(s) 276
EcoRV GATATC 1 cut(s) 56
FaiI YATR 4 cut(s) 31, 77, 79, 230
FauNDI CATATG 1 cut(s) 77
Fnu4HI GCNGC 1 cut(s) 247
FokI GGATG 2 cut(s) 23, 172
Fsp4HI GCNGC 1 cut(s) 247
GluI GCNGC 1 cut(s) 247
HaeIII GGCC 1 cut(s) 246
HapII CCGG 1 cut(s) 142
HinfI GANTC 2 cut(s) 82, 114
HpaII CCGG 1 cut(s) 142
Hpy188III TCNNGA 2 cut(s) 86, 189
HpyCH4V TGCA 2 cut(s) 185, 232
HpyF10VI GCNNNNNNNGC 1 cut(s) 182
LpnPI CCDG 6 cut(s) 44, 96, 155, 202, 221, 263
LweI GCATC 1 cut(s) 194
MluCI AATT 1 cut(s) 97
MlyI GAGTC 1 cut(s) 76
MmeI TCCRAC 2 cut(s) 64, 220
MnlI CCTC 6 cut(s) 19, 82, 121, 222, 228, 236
MspI CCGG 1 cut(s) 142
MspR9I CCNGG 1 cut(s) 278
MvaI CCWGG 1 cut(s) 278
MwoI GCNNNNNNNGC 1 cut(s) 182
NdeI CATATG 1 cut(s) 77
PfeI GAWTC 1 cut(s) 114
PkrI GCNGC 1 cut(s) 248
PleI GAGTC 1 cut(s) 76
PpsI GAGTC 1 cut(s) 76
Psp6I CCWGG 1 cut(s) 276
PspGI CCWGG 1 cut(s) 276
PspPI GGNCC 1 cut(s) 64
SatI GCNGC 1 cut(s) 247
Sau96I GGNCC 1 cut(s) 64
SchI GAGTC 1 cut(s) 76
ScrFI CCNGG 1 cut(s) 278
SetI ASST 4 cut(s) 30, 112, 220, 273
SfaNI GCATC 1 cut(s) 194
SinI GGWCC 1 cut(s) 64
SmlI CTYRAG 1 cut(s) 84
SmoI CTYRAG 1 cut(s) 84
Sse9I AATT 1 cut(s) 97
SsiI CCGC 1 cut(s) 247
StyD4I CCNGG 1 cut(s) 276
TaqI TCGA 1 cut(s) 101
TasI AATT 1 cut(s) 97
TauI GCSGC 1 cut(s) 249
TfiI GAWTC 1 cut(s) 114
TspDTI ATGAA 2 cut(s) 17, 27
VpaK11BI GGWCC 1 cut(s) 64
XagI CCTNNNNNAGG 1 cut(s) 275
XapI RAATTY 1 cut(s) 97
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.