Rmu_sc0001408.1_g000023

La-related protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001408.1
Physical Location & Seq
Reverse (-)
123073 .. 125124
2052 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001408.1_g000023.1.cds

Sequence Viewer

Length: 501 bp
atgcccttgcaaggcgatctcattaccgctagatttgcgagttgtcactttgatgagacagtcttctattcagtgtttgtgggctctgtggagtattatttcagtgatctgaacttagctactactgatcatcttatgaggttcataaacaaagaccctgaaggatttgtgccaatatctgttgttgcatctttcaagaagattaaggccctcgtaagtagtcattcccagcttgcaactgtattgcggaactcctcaaagcttgtggagtattatttcagtgatctgaacttagctactactgatcatcttatgaggttcataaacaaagaccctgaaggatttgtgccaatatctgttgttgcatctttcaagaagattaaggccctcgtaagtagtcattcccagcttgcaactgtattgcggaactcctcaaagcttgtgagttcacttatttgtgctctggcttcatattatgttgttgtacgtaaaggctcttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

166

Amino Acids

18.46

Weight (kDa)

9.08

Isoelectric Point (pI)

35.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018165)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 27, 247, 424
AcuI CTGAAG 2 cut(s) 180, 357
AfaI GTAC 1 cut(s) 486
AfiI CCNNNNNNNGG 1 cut(s) 11
AgsI TTSAA 2 cut(s) 196, 373
AluBI AGCT 6 cut(s) 119, 232, 262, 296, 409, 439
AluI AGCT 6 cut(s) 119, 232, 262, 296, 409, 439
Alw21I GWGCWC 1 cut(s) 463
Alw26I GTCTC 1 cut(s) 50
AoxI GGCC 2 cut(s) 207, 384
AspS9I GGNCC 2 cut(s) 208, 385
BanII GRGCYC 1 cut(s) 86
BbsI GAAGAC 1 cut(s) 55
Bbv12I GWGCWC 1 cut(s) 463
BclI TGATCA 2 cut(s) 127, 304
BcoDI GTCTC 1 cut(s) 50
BfaI CTAG 1 cut(s) 30
BmgT120I GGNCC 2 cut(s) 208, 385
BmsI GCATC 2 cut(s) 197, 374
BpiI GAAGAC 1 cut(s) 55
BsaAI YACGTR 1 cut(s) 488
Bsc4I CCNNNNNNNGG 1 cut(s) 11
BseLI CCNNNNNNNGG 1 cut(s) 11
BseRI GAGGAG 2 cut(s) 244, 421
BseYI CCCAGC 2 cut(s) 228, 405
BshFI GGCC 2 cut(s) 209, 386
BsiHKAI GWGCWC 1 cut(s) 463
BslI CCNNNNNNNGG 1 cut(s) 11
BsmAI GTCTC 1 cut(s) 50
BsnI GGCC 2 cut(s) 209, 386
Bsp1286I GDGCHC 2 cut(s) 86, 463
Bsp143I GATC 5 cut(s) 16, 106, 127, 283, 304
BspACI CCGC 3 cut(s) 27, 247, 424
BspANI GGCC 2 cut(s) 209, 386
BssMI GATC 5 cut(s) 16, 106, 127, 283, 304
Bst4CI ACNGT 3 cut(s) 61, 241, 418
BstBAI YACGTR 1 cut(s) 488
BstC8I GCNNGC 2 cut(s) 234, 411
BstDEI CTNAG 2 cut(s) 115, 292
BstKTI GATC 5 cut(s) 19, 109, 130, 286, 307
BstMAI GTCTC 1 cut(s) 50
BstMBI GATC 5 cut(s) 16, 106, 127, 283, 304
BstMWI GCNNNNNNNGC 1 cut(s) 35
BstSNI TACGTA 1 cut(s) 488
BstV2I GAAGAC 1 cut(s) 55
BsuRI GGCC 2 cut(s) 209, 386
BtsIMutI CAGTG 3 cut(s) 78, 109, 286
Cac8I GCNNGC 2 cut(s) 234, 411
Cfr13I GGNCC 2 cut(s) 208, 385
Csp6I GTAC 1 cut(s) 485
CspCI CAANNNNNGTGG 2 cut(s) 246, 281
CviQI GTAC 1 cut(s) 485
DdeI CTNAG 2 cut(s) 115, 292
DpnI GATC 5 cut(s) 18, 108, 129, 285, 306
DpnII GATC 5 cut(s) 16, 106, 127, 283, 304
Eco105I TACGTA 1 cut(s) 488
Eco24I GRGCYC 1 cut(s) 86
Eco57I CTGAAG 2 cut(s) 180, 357
EcoO109I RGGNCCY 2 cut(s) 208, 385
EcoT38I GRGCYC 1 cut(s) 86
FaiI YATR 6 cut(s) 137, 146, 314, 323, 472, 477
FbaI TGATCA 2 cut(s) 127, 304
FriOI GRGCYC 1 cut(s) 86
FspBI CTAG 1 cut(s) 30
GsaI CCCAGC 2 cut(s) 232, 409
HaeIII GGCC 2 cut(s) 209, 386
HindIII AAGCTT 2 cut(s) 260, 437
Hpy166II GTNNAC 1 cut(s) 449
Hpy188I TCNGA 2 cut(s) 111, 288
Hpy188III TCNNGA 2 cut(s) 196, 373
Hpy8I GTNNAC 1 cut(s) 449
HpyAV CCTTC 2 cut(s) 155, 332
HpyCH4III ACNGT 3 cut(s) 61, 241, 418
HpyCH4IV ACGT 1 cut(s) 487
HpyCH4V TGCA 5 cut(s) 10, 188, 236, 365, 413
HpyF10VI GCNNNNNNNGC 1 cut(s) 35
HpyF3I CTNAG 2 cut(s) 115, 292
HpySE526I ACGT 1 cut(s) 487
Ksp22I TGATCA 2 cut(s) 127, 304
Kzo9I GATC 5 cut(s) 16, 106, 127, 283, 304
LpnPI CCDG 5 cut(s) 171, 242, 348, 419, 449
LweI GCATC 2 cut(s) 197, 374
MaeI CTAG 1 cut(s) 30
MaeII ACGT 1 cut(s) 487
MaeIII GTNAC 1 cut(s) 44
MalI GATC 5 cut(s) 18, 108, 129, 285, 306
MboI GATC 5 cut(s) 16, 106, 127, 283, 304
MboII GAAGA 3 cut(s) 55, 211, 388
MhlI GDGCHC 2 cut(s) 86, 463
MnlI CCTC 6 cut(s) 132, 221, 265, 309, 398, 442
MseI TTAA 3 cut(s) 204, 381, 499
MslI CAYNNNNRTG 1 cut(s) 51
MwoI GCNNNNNNNGC 1 cut(s) 35
NdeII GATC 5 cut(s) 16, 106, 127, 283, 304
NmuCI GTSAC 1 cut(s) 44
Ppu21I YACGTR 1 cut(s) 488
PspFI CCCAGC 2 cut(s) 228, 405
PspPI GGNCC 2 cut(s) 208, 385
RsaI GTAC 1 cut(s) 486
RsaNI GTAC 1 cut(s) 485
RseI CAYNNNNRTG 1 cut(s) 51
SaqAI TTAA 3 cut(s) 204, 381, 499
Sau3AI GATC 5 cut(s) 16, 106, 127, 283, 304
Sau96I GGNCC 2 cut(s) 208, 385
SduI GDGCHC 2 cut(s) 86, 463
SetI ASST 9 cut(s) 121, 143, 234, 264, 298, 320, 411, 441, 490
SfaNI GCATC 2 cut(s) 197, 374
SmiMI CAYNNNNRTG 1 cut(s) 51
SnaBI TACGTA 1 cut(s) 488
SsiI CCGC 3 cut(s) 27, 247, 424
SspMI CTAG 1 cut(s) 30
TaaI ACNGT 3 cut(s) 61, 241, 418
TaiI ACGT 1 cut(s) 490
Tru1I TTAA 3 cut(s) 204, 381, 499
Tru9I TTAA 3 cut(s) 204, 381, 499
TscAI CASTG 3 cut(s) 78, 109, 286
TseFI GTSAC 1 cut(s) 44
Tsp45I GTSAC 1 cut(s) 44
TspDTI ATGAA 3 cut(s) 133, 310, 459
TspRI CASTG 3 cut(s) 78, 109, 286
XspI CTAG 1 cut(s) 30
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.