Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr5B

Orthogroup ID

OG0018165

Physical Location & Seq

Genomic Coordinates Reverse (-)

62679934 .. 62680424

Gene Structure 491 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh5BG392000.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 210 bp

ATGAGGTTCATAAACAAAGACCCAGAAGGATTTGTGCCAATATCTGTTGTTGCATCTTTCAAGAAGATTAAGGCCCTCGTAAGTAGTCATTCCCAGCTTGCAACTGTATTGCGGAACTCCTCAAAGCTTGTGAGTTCACTTATTTGTGCTCTGGCTTCATATTATGTTGTTGTACGAAAAGGCTTTCAAAGATTTGTTTTGAGTCACTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003676 GO:0003723 GO:0003729 GO:0005488 GO:0097159 GO:1901363

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

La PAM2 RRM_1

Protein Analysis

69

Amino Acids

7.67

Weight (kDa)

10.46

Isoelectric Point (pI)

27.94

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
La	PF05383	2 - 39	4.2e-09	La domain

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018165)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr2g0114761 RchiOBHm_Chr6g0277201
rosa_multiflora	Rmu_sc0001218.1_g000043 Rmu_sc0001408.1_g000023
rosa_roxburghii	Rroxscaffold_6G00399270
rosa_samantha	Rh2CG253800 Rh3AG316700 Rh5BG392000 Rh5CG262300 Rh6AG315600
rosa_wichuraiana	Rw1G004620

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	112
AfaI	GTAC	1 cut(s)	174
AgsI	TTSAA	2 cut(s)	61, 188
AluBI	AGCT	2 cut(s)	97, 127
AluI	AGCT	2 cut(s)	97, 127
Alw21I	GWGCWC	1 cut(s)	151
AoxI	GGCC	1 cut(s)	72
AspS9I	GGNCC	1 cut(s)	73
Bbv12I	GWGCWC	1 cut(s)	151
BmgT120I	GGNCC	1 cut(s)	73
BmsI	GCATC	1 cut(s)	62
BseRI	GAGGAG	1 cut(s)	109
BseYI	CCCAGC	1 cut(s)	93
BshFI	GGCC	1 cut(s)	74
BsiHKAI	GWGCWC	1 cut(s)	151
BsnI	GGCC	1 cut(s)	74
Bsp1286I	GDGCHC	1 cut(s)	151
BspACI	CCGC	1 cut(s)	112
BspANI	GGCC	1 cut(s)	74
Bst4CI	ACNGT	1 cut(s)	106
BstC8I	GCNNGC	1 cut(s)	99
BsuRI	GGCC	1 cut(s)	74
BtsIMutI	CAGTG	1 cut(s)	205
Cac8I	GCNNGC	1 cut(s)	99
Cfr13I	GGNCC	1 cut(s)	73
Csp6I	GTAC	1 cut(s)	173
CviJI	RGCY	5 cut(s)	74, 97, 127, 155, 183
CviKI_1	RGCY	5 cut(s)	74, 97, 127, 155, 183
CviQI	GTAC	1 cut(s)	173
EcoO109I	RGGNCCY	1 cut(s)	73
FaiI	YATR	3 cut(s)	11, 160, 165
GsaI	CCCAGC	1 cut(s)	97
HaeIII	GGCC	1 cut(s)	74
HindIII	AAGCTT	1 cut(s)	125
HinfI	GANTC	1 cut(s)	202
Hpy166II	GTNNAC	1 cut(s)	137
Hpy188III	TCNNGA	1 cut(s)	61
Hpy8I	GTNNAC	1 cut(s)	137
HpyAV	CCTTC	1 cut(s)	20
HpyCH4III	ACNGT	1 cut(s)	106
HpyCH4V	TGCA	2 cut(s)	53, 101
LpnPI	CCDG	3 cut(s)	36, 107, 137
LweI	GCATC	1 cut(s)	62
MaeIII	GTNAC	1 cut(s)	203
MboII	GAAGA	1 cut(s)	76
MhlI	GDGCHC	1 cut(s)	151
MnlI	CCTC	2 cut(s)	86, 130
MseI	TTAA	1 cut(s)	69
NmuCI	GTSAC	1 cut(s)	203
PspFI	CCCAGC	1 cut(s)	93
PspPI	GGNCC	1 cut(s)	73
RsaI	GTAC	1 cut(s)	174
RsaNI	GTAC	1 cut(s)	173
SaqAI	TTAA	1 cut(s)	69
Sau96I	GGNCC	1 cut(s)	73
SduI	GDGCHC	1 cut(s)	151
SetI	ASST	3 cut(s)	8, 99, 129
SfaNI	GCATC	1 cut(s)	62
SgeI	CNNG	7 cut(s)	35, 73, 89, 106, 110, 140, 164
SsiI	CCGC	1 cut(s)	112
TaaI	ACNGT	1 cut(s)	106
Tru1I	TTAA	1 cut(s)	69
Tru9I	TTAA	1 cut(s)	69
TseFI	GTSAC	1 cut(s)	203
Tsp45I	GTSAC	1 cut(s)	203
TspDTI	ATGAA	1 cut(s)	147

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.