Rmu_sc0001800.1_g000025

Belongs to the Casparian strip membrane proteins (CASP) family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001800.1
Physical Location & Seq
Reverse (-)
117953 .. 118810
858 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001800.1_g000025.1.cds

Sequence Viewer

Length: 459 bp
atgaagaattttcctgggactcctgggactttgactgggcttcttctcaggattttacaatgcgtctttgctgctgcctctattgcttccatggccaccacctccagcttcttcaatttcacagctttctgctacctgattgcttcaatgggtctgcaagtgatttggagttttgttctggcattgttagatgcatattccttgatgaaaaagaaggccctccacaaccctgtattggtcagcctctttgtagttggagactgggttacagcaacactgtctcttgcagctgcttctgcttcagctggaataactgtcctatactttagtgacttgagccactgcagttttggagaggaatgccaaaaataccagatggcagttgcttttgcttacctgagttgggtaacaattgcaatttcttctctaatcatgctctggctattggcagcaggttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

152

Amino Acids

16.33

Weight (kDa)

7.66

Isoelectric Point (pI)

22.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012397)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 443
AcoI YGGCCR 1 cut(s) 93
AcsI RAATTY 1 cut(s) 7
AcuI CTGAAG 1 cut(s) 285
AfiI CCNNNNNNNGG 2 cut(s) 235, 403
AgsI TTSAA 2 cut(s) 115, 147
AjnI CCWGG 2 cut(s) 13, 22
AluBI AGCT 4 cut(s) 108, 125, 290, 305
AluI AGCT 4 cut(s) 108, 125, 290, 305
Alw26I GTCTC 2 cut(s) 252, 285
AoxI GGCC 2 cut(s) 93, 216
ApeKI GCWGC 5 cut(s) 71, 74, 287, 290, 449
ApoI RAATTY 1 cut(s) 7
AspS9I GGNCC 1 cut(s) 217
BalI TGGCCA 1 cut(s) 95
BbvI GCAGC 4 cut(s) 58, 61, 277, 299
BccI CCATC 1 cut(s) 370
BciT130I CCWGG 2 cut(s) 15, 24
BcoDI GTCTC 2 cut(s) 252, 285
BfmI CTRYAG 1 cut(s) 343
BfuAI ACCTGC 1 cut(s) 443
BisI GCNGC 5 cut(s) 72, 75, 288, 291, 450
BlsI GCNGC 5 cut(s) 73, 76, 289, 292, 451
Bme1390I CCNGG 2 cut(s) 15, 24
BmgT120I GGNCC 1 cut(s) 217
BmrFI CCNGG 2 cut(s) 15, 24
BmrI ACTGGG 2 cut(s) 45, 271
BmsI GCATC 1 cut(s) 181
BmuI ACTGGG 2 cut(s) 45, 271
BpmI CTGGAG 1 cut(s) 88
BpuEI CTTGAG 1 cut(s) 355
BsaJI CCNNGG 3 cut(s) 14, 23, 90
BsaXI ACNNNNNCTCC 2 cut(s) 249, 279
Bsc4I CCNNNNNNNGG 2 cut(s) 235, 403
Bse1I ACTGG 2 cut(s) 40, 266
BseBI CCWGG 2 cut(s) 15, 24
BseDI CCNNGG 3 cut(s) 14, 23, 90
BseLI CCNNNNNNNGG 2 cut(s) 235, 403
BseMII CTCAG 2 cut(s) 61, 389
BseNI ACTGG 2 cut(s) 40, 266
BseXI GCAGC 4 cut(s) 58, 61, 277, 299
BshFI GGCC 2 cut(s) 95, 218
BslFI GGGAC 2 cut(s) 31, 40
BslI CCNNNNNNNGG 2 cut(s) 235, 403
BsmAI GTCTC 2 cut(s) 252, 285
BsmFI GGGAC 2 cut(s) 31, 40
BsmI GAATGC 1 cut(s) 365
BsnI GGCC 2 cut(s) 95, 218
Bsp19I CCATGG 1 cut(s) 90
BspANI GGCC 2 cut(s) 95, 218
BspCNI CTCAG 2 cut(s) 60, 390
BspMAI CTGCAG 1 cut(s) 347
BspMI ACCTGC 1 cut(s) 443
BsrI ACTGG 2 cut(s) 40, 266
BssECI CCNNGG 3 cut(s) 14, 23, 90
BssT1I CCWWGG 1 cut(s) 90
Bst2UI CCWGG 2 cut(s) 15, 24
Bst4CI ACNGT 2 cut(s) 279, 316
BstDEI CTNAG 2 cut(s) 47, 398
BstDSI CCRYGG 1 cut(s) 90
BstMAI GTCTC 2 cut(s) 252, 285
BstMWI GCNNNNNNNGC 3 cut(s) 83, 92, 296
BstNI CCWGG 2 cut(s) 15, 24
BstSCI CCNGG 2 cut(s) 13, 22
BstSFI CTRYAG 1 cut(s) 343
BstV1I GCAGC 4 cut(s) 58, 61, 277, 299
BsuRI GGCC 2 cut(s) 95, 218
BtgI CCRYGG 1 cut(s) 90
BtsI GCAGTG 1 cut(s) 340
BtsIMutI CAGTG 2 cut(s) 275, 340
BveI ACCTGC 1 cut(s) 443
Cfr13I GGNCC 1 cut(s) 217
CseI GACGC 1 cut(s) 52
CviAII CATG 2 cut(s) 91, 433
DdeI CTNAG 2 cut(s) 47, 398
EaeI YGGCCR 1 cut(s) 93
Eco130I CCWWGG 1 cut(s) 90
Eco57I CTGAAG 1 cut(s) 285
EcoO109I RGGNCCY 1 cut(s) 217
EcoRII CCWGG 2 cut(s) 13, 22
EcoT14I CCWWGG 1 cut(s) 90
EcoT22I ATGCAT 1 cut(s) 196
ErhI CCWWGG 1 cut(s) 90
FaeI CATG 2 cut(s) 94, 436
FaiI YATR 4 cut(s) 92, 196, 322, 434
FaqI GGGAC 2 cut(s) 31, 40
FatI CATG 2 cut(s) 90, 432
Fnu4HI GCNGC 5 cut(s) 72, 75, 288, 291, 450
Fsp4HI GCNGC 5 cut(s) 72, 75, 288, 291, 450
GluI GCNGC 5 cut(s) 72, 75, 288, 291, 450
GsuI CTGGAG 1 cut(s) 88
HaeIII GGCC 2 cut(s) 95, 218
HgaI GACGC 1 cut(s) 52
Hin1II CATG 2 cut(s) 94, 436
HinfI GANTC 1 cut(s) 19
Hpy188III TCNNGA 1 cut(s) 49
HpyAV CCTTC 1 cut(s) 208
HpyCH4III ACNGT 2 cut(s) 279, 316
HpyCH4V TGCA 5 cut(s) 157, 194, 287, 345, 416
HpyF10VI GCNNNNNNNGC 3 cut(s) 83, 92, 296
HpyF3I CTNAG 2 cut(s) 47, 398
Hsp92II CATG 2 cut(s) 94, 436
Lsp1109I GCAGC 4 cut(s) 58, 61, 277, 299
LweI GCATC 1 cut(s) 181
MaeIII GTNAC 3 cut(s) 265, 329, 406
MboII GAAGA 4 cut(s) 16, 35, 103, 414
MfeI CAATTG 1 cut(s) 411
MlsI TGGCCA 1 cut(s) 95
MluCI AATT 4 cut(s) 7, 115, 411, 417
MluNI TGGCCA 1 cut(s) 95
MlyI GAGTC 1 cut(s) 13
MmeI TCCRAC 1 cut(s) 235
MnlI CCTC 5 cut(s) 88, 112, 230, 254, 349
Mox20I TGGCCA 1 cut(s) 95
Mph1103I ATGCAT 1 cut(s) 196
MscI TGGCCA 1 cut(s) 95
Msp20I TGGCCA 1 cut(s) 95
MspA1I CMGCKG 2 cut(s) 290, 305
MspR9I CCNGG 2 cut(s) 15, 24
MunI CAATTG 1 cut(s) 411
Mva1269I GAATGC 1 cut(s) 365
MvaI CCWGG 2 cut(s) 15, 24
MwoI GCNNNNNNNGC 3 cut(s) 83, 92, 296
NcoI CCATGG 1 cut(s) 90
NlaIII CATG 2 cut(s) 94, 436
NmuCI GTSAC 1 cut(s) 329
NsiI ATGCAT 1 cut(s) 196
PctI GAATGC 1 cut(s) 365
PkrI GCNGC 5 cut(s) 73, 76, 289, 292, 451
PleI GAGTC 1 cut(s) 13
PpsI GAGTC 1 cut(s) 13
Psp6I CCWGG 2 cut(s) 13, 22
PspGI CCWGG 2 cut(s) 13, 22
PspPI GGNCC 1 cut(s) 217
PstI CTGCAG 1 cut(s) 347
PvuII CAGCTG 2 cut(s) 290, 305
SatI GCNGC 5 cut(s) 72, 75, 288, 291, 450
Sau96I GGNCC 1 cut(s) 217
SchI GAGTC 1 cut(s) 13
ScrFI CCNGG 2 cut(s) 15, 24
SetI ASST 8 cut(s) 104, 110, 127, 138, 292, 307, 399, 457
SfaNI GCATC 1 cut(s) 181
SfcI CTRYAG 1 cut(s) 343
SmlI CTYRAG 1 cut(s) 334
SmoI CTYRAG 1 cut(s) 334
Sse9I AATT 4 cut(s) 7, 115, 411, 417
StyD4I CCNGG 2 cut(s) 13, 22
StyI CCWWGG 1 cut(s) 90
TaaI ACNGT 2 cut(s) 279, 316
TasI AATT 4 cut(s) 7, 115, 411, 417
TscAI CASTG 2 cut(s) 282, 347
TseFI GTSAC 1 cut(s) 329
TseI GCWGC 5 cut(s) 71, 74, 287, 290, 449
Tsp45I GTSAC 1 cut(s) 329
TspDTI ATGAA 2 cut(s) 17, 221
TspRI CASTG 2 cut(s) 282, 347
XapI RAATTY 1 cut(s) 7
XcmI CCANNNNNNNNNTGG 1 cut(s) 347
Zsp2I ATGCAT 1 cut(s) 196
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.