Rorug03G0338500

Belongs to the Casparian strip membrane proteins (CASP) family

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000003
Physical Location & Seq
Forward (+)
40003071 .. 40003392
322 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug03G0338500.1

Sequence Viewer

Length: 258 bp
ATGACAGGGTTAAATTATGCGCTTGCTTTGAGCGTATCAATTACATGGGTGAATTGGTCAAGGGGTGGTGCTCATCCTCGGAAATTTGGATGGCCGGATATTACAGATGAGTTTTTTAATGGAATTCGTTTCGGATCGCACTGCAAATACAACGGCAATACAACTTCAATATGTTTCTTATTTGGTAGAAAGTTTTTGCCTAATGCTCTGGAGCCTTTGTTACGAGTTGCTCCATTGCTGCTTGGCTTTGATACCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

85

Amino Acids

9.54

Weight (kDa)

9.24

Isoelectric Point (pI)

9.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012397)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 142
AcoI YGGCCR 1 cut(s) 92
AcsI RAATTY 2 cut(s) 83, 123
AgsI TTSAA 1 cut(s) 168
Alw21I GWGCWC 1 cut(s) 73
AlwI GGATC 1 cut(s) 142
AoxI GGCC 1 cut(s) 92
ApeKI GCWGC 1 cut(s) 238
ApoI RAATTY 2 cut(s) 83, 123
AspLEI GCGC 1 cut(s) 22
AsuHPI GGTGA 1 cut(s) 61
Bbv12I GWGCWC 1 cut(s) 73
BbvI GCAGC 1 cut(s) 225
BccI CCATC 1 cut(s) 84
BceAI ACGGC 1 cut(s) 169
BfaI CTAG 1 cut(s) 256
BisI GCNGC 1 cut(s) 239
BlsI GCNGC 1 cut(s) 240
BmiI GGNNCC 1 cut(s) 213
BpmI CTGGAG 1 cut(s) 230
BsaJI CCNNGG 1 cut(s) 77
BsaXI ACNNNNNCTCC 2 cut(s) 203, 233
Bse3DI GCAATG 1 cut(s) 233
BseDI CCNNGG 1 cut(s) 77
BseGI GGATG 2 cut(s) 73, 95
BseMI GCAATG 1 cut(s) 233
BseXI GCAGC 1 cut(s) 225
BshFI GGCC 1 cut(s) 94
BsiHKAI GWGCWC 1 cut(s) 73
BsiSI CCGG 1 cut(s) 95
BsnI GGCC 1 cut(s) 94
Bsp1286I GDGCHC 1 cut(s) 73
Bsp143I GATC 1 cut(s) 134
BspANI GGCC 1 cut(s) 94
BspLI GGNNCC 1 cut(s) 213
BspPI GGATC 1 cut(s) 142
BsrDI GCAATG 1 cut(s) 233
BssECI CCNNGG 1 cut(s) 77
BssMI GATC 1 cut(s) 134
BstC8I GCNNGC 1 cut(s) 24
BstF5I GGATG 2 cut(s) 73, 95
BstHHI GCGC 1 cut(s) 22
BstKTI GATC 1 cut(s) 137
BstMBI GATC 1 cut(s) 134
BstV1I GCAGC 1 cut(s) 225
BsuRI GGCC 1 cut(s) 94
BtsCI GGATG 2 cut(s) 73, 95
BtsI GCAGTG 1 cut(s) 139
BtsIMutI CAGTG 1 cut(s) 139
Cac8I GCNNGC 1 cut(s) 24
CfoI GCGC 1 cut(s) 22
CviAII CATG 1 cut(s) 45
CviJI RGCY 3 cut(s) 94, 214, 246
CviKI_1 RGCY 3 cut(s) 94, 214, 246
DpnI GATC 1 cut(s) 136
DpnII GATC 1 cut(s) 134
EaeI YGGCCR 1 cut(s) 92
EcoRI GAATTC 1 cut(s) 123
FaeI CATG 1 cut(s) 48
FaiI YATR 3 cut(s) 18, 46, 172
FatI CATG 1 cut(s) 44
Fnu4HI GCNGC 1 cut(s) 239
FokI GGATG 2 cut(s) 60, 102
Fsp4HI GCNGC 1 cut(s) 239
FspBI CTAG 1 cut(s) 256
GlaI GCGC 1 cut(s) 21
GluI GCNGC 1 cut(s) 239
GsuI CTGGAG 1 cut(s) 230
HaeIII GGCC 1 cut(s) 94
HapII CCGG 1 cut(s) 95
HhaI GCGC 1 cut(s) 22
Hin1II CATG 1 cut(s) 48
Hin6I GCGC 1 cut(s) 20
HinP1I GCGC 1 cut(s) 20
HpaII CCGG 1 cut(s) 95
HphI GGTGA 1 cut(s) 61
Hpy188I TCNGA 2 cut(s) 81, 134
Hpy188III TCNNGA 1 cut(s) 209
HpyCH4V TGCA 1 cut(s) 144
Hsp92II CATG 1 cut(s) 48
HspAI GCGC 1 cut(s) 20
Kzo9I GATC 1 cut(s) 134
LmnI GCTCC 2 cut(s) 211, 235
LpnPI CCDG 2 cut(s) 108, 194
Lsp1109I GCAGC 1 cut(s) 225
MaeI CTAG 1 cut(s) 256
MaeIII GTNAC 1 cut(s) 219
MalI GATC 1 cut(s) 136
MboI GATC 1 cut(s) 134
MhlI GDGCHC 1 cut(s) 73
MluCI AATT 5 cut(s) 13, 39, 52, 83, 123
MnlI CCTC 1 cut(s) 87
MseI TTAA 2 cut(s) 11, 117
MspI CCGG 1 cut(s) 95
NdeII GATC 1 cut(s) 134
NlaIII CATG 1 cut(s) 48
NlaIV GGNNCC 1 cut(s) 213
PkrI GCNGC 1 cut(s) 240
PspN4I GGNNCC 1 cut(s) 213
SaqAI TTAA 2 cut(s) 11, 117
SatI GCNGC 1 cut(s) 239
Sau3AI GATC 1 cut(s) 134
SduI GDGCHC 1 cut(s) 73
SetI ASST 1 cut(s) 257
SgeI CNNG 9 cut(s) 18, 35, 57, 72, 90, 107, 221, 236, 254
Sse9I AATT 5 cut(s) 13, 39, 52, 83, 123
SspMI CTAG 1 cut(s) 256
TasI AATT 5 cut(s) 13, 39, 52, 83, 123
Tru1I TTAA 2 cut(s) 11, 117
Tru9I TTAA 2 cut(s) 11, 117
TscAI CASTG 1 cut(s) 146
TseI GCWGC 1 cut(s) 238
TspRI CASTG 1 cut(s) 146
XapI RAATTY 2 cut(s) 83, 123
XspI CTAG 1 cut(s) 256
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.