Rmu_sc0001803.1_g000003

Belongs to the Frigida family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001803.1
OG0019048
Physical Location & Seq
Reverse (-)
12285 .. 12671
387 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 387 bp
atgttagtctggaaggagctctccaaccatttcctctcactcgatcagaagctccttcataaatcggaggccatcaagatcaaaatccaaaccctagagtacaagatcaaggagagcctcgacgagctcaagcaacgagagaacatcatcaaccagtgcgtcgagatcccgctcgtcaaggtagaggagaccaagaaggccgcgttgaaggtcctcaagaaagcccgctctgacaacaagtacggcgaggtggataatagcgagggattgttgatggagatgaagtcactgtgcttgaagatggatttggggatagtcacagagaaagagatgagcttttgcagttttggcgttgtcaggaatgggtcgaaacgaagttggatttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Frigida

Protein Analysis

128

Amino Acids

14.8

Weight (kDa)

8.93

Isoelectric Point (pI)

29.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 2 cut(s) 172, 228
AccII CGCG 1 cut(s) 203
AciI CCGC 3 cut(s) 170, 201, 226
AclWI GGATC 1 cut(s) 160
AfaI GTAC 2 cut(s) 101, 242
AgsI TTSAA 2 cut(s) 208, 298
AjuI GAANNNNNNNTTGG 2 cut(s) 290, 322
AluBI AGCT 4 cut(s) 19, 52, 127, 336
AluI AGCT 4 cut(s) 19, 52, 127, 336
Alw21I GWGCWC 2 cut(s) 21, 129
Alw26I GTCTC 1 cut(s) 182
AlwI GGATC 1 cut(s) 160
AoxI GGCC 2 cut(s) 69, 198
AspS9I GGNCC 1 cut(s) 211
AvaII GGWCC 1 cut(s) 211
BanII GRGCYC 2 cut(s) 21, 129
Bbv12I GWGCWC 2 cut(s) 21, 129
BccI CCATC 3 cut(s) 80, 268, 295
BceAI ACGGC 1 cut(s) 259
BcoDI GTCTC 1 cut(s) 182
BfaI CTAG 1 cut(s) 95
BisI GCNGC 1 cut(s) 201
BlsI GCNGC 1 cut(s) 202
Bme18I GGWCC 1 cut(s) 211
BmgT120I GGNCC 1 cut(s) 211
BpuEI CTTGAG 2 cut(s) 113, 200
BsaBI GATNNNNATC 1 cut(s) 83
BsaI GGTCTC 1 cut(s) 182
BsaXI ACNNNNNCTCC 2 cut(s) 269, 299
Bse1I ACTGG 1 cut(s) 154
Bse8I GATNNNNATC 1 cut(s) 83
BseJI GATNNNNATC 1 cut(s) 83
BseNI ACTGG 1 cut(s) 154
BseRI GAGGAG 1 cut(s) 200
Bsh1236I CGCG 1 cut(s) 203
BshFI GGCC 2 cut(s) 71, 200
BsiHKAI GWGCWC 2 cut(s) 21, 129
BsmAI GTCTC 1 cut(s) 182
BsnI GGCC 2 cut(s) 71, 200
Bso31I GGTCTC 1 cut(s) 182
Bsp1286I GDGCHC 2 cut(s) 21, 129
Bsp143I GATC 4 cut(s) 43, 78, 105, 165
BspACI CCGC 3 cut(s) 170, 201, 226
BspANI GGCC 2 cut(s) 71, 200
BspFNI CGCG 1 cut(s) 203
BspPI GGATC 1 cut(s) 160
BspTNI GGTCTC 1 cut(s) 182
BsrBI CCGCTC 2 cut(s) 172, 228
BsrI ACTGG 1 cut(s) 154
BssMI GATC 4 cut(s) 43, 78, 105, 165
Bst4CI ACNGT 1 cut(s) 291
BstC8I GCNNGC 1 cut(s) 226
BstFNI CGCG 1 cut(s) 203
BstKTI GATC 4 cut(s) 46, 81, 108, 168
BstMAI GTCTC 1 cut(s) 182
BstMBI GATC 4 cut(s) 43, 78, 105, 165
BstMWI GCNNNNNNNGC 1 cut(s) 348
BstUI CGCG 1 cut(s) 203
BstX2I RGATCY 1 cut(s) 165
BstYI RGATCY 1 cut(s) 165
BsuRI GGCC 2 cut(s) 71, 200
BtsIMutI CAGTG 2 cut(s) 161, 287
Cac8I GCNNGC 1 cut(s) 226
Cfr13I GGNCC 1 cut(s) 211
CseI GACGC 1 cut(s) 148
Csp6I GTAC 2 cut(s) 100, 241
CviJI RGCY 8 cut(s) 19, 52, 71, 117, 127, 200, 224, 336
CviKI_1 RGCY 8 cut(s) 19, 52, 71, 117, 127, 200, 224, 336
CviQI GTAC 2 cut(s) 100, 241
DpnI GATC 4 cut(s) 45, 80, 107, 167
DpnII GATC 4 cut(s) 43, 78, 105, 165
Ecl136II GAGCTC 2 cut(s) 19, 127
Eco24I GRGCYC 2 cut(s) 21, 129
Eco31I GGTCTC 1 cut(s) 182
Eco47I GGWCC 1 cut(s) 211
Eco53kI GAGCTC 2 cut(s) 19, 127
EcoICRI GAGCTC 2 cut(s) 19, 127
EcoO109I RGGNCCY 1 cut(s) 211
EcoT38I GRGCYC 2 cut(s) 21, 129
FaiI YATR 1 cut(s) 60
FauI CCCGC 2 cut(s) 177, 233
Fnu4HI GCNGC 1 cut(s) 201
FriOI GRGCYC 2 cut(s) 21, 129
Fsp4HI GCNGC 1 cut(s) 201
FspBI CTAG 1 cut(s) 95
GluI GCNGC 1 cut(s) 201
HaeIII GGCC 2 cut(s) 71, 200
HgaI GACGC 1 cut(s) 148
Hpy188I TCNGA 3 cut(s) 48, 67, 232
Hpy188III TCNNGA 5 cut(s) 10, 76, 163, 217, 358
Hpy99I CGWCG 2 cut(s) 125, 164
HpyAV CCTTC 4 cut(s) 7, 65, 190, 202
HpyCH4III ACNGT 1 cut(s) 291
HpyCH4V TGCA 1 cut(s) 342
HpyF10VI GCNNNNNNNGC 1 cut(s) 348
Kzo9I GATC 4 cut(s) 43, 78, 105, 165
LmnI GCTCC 2 cut(s) 16, 57
LpnPI CCDG 2 cut(s) 167, 343
MaeI CTAG 1 cut(s) 95
MaeIII GTNAC 2 cut(s) 285, 316
MalI GATC 4 cut(s) 45, 80, 107, 167
MbiI CCGCTC 2 cut(s) 172, 228
MboI GATC 4 cut(s) 43, 78, 105, 165
MboII GAAGA 1 cut(s) 310
MflI RGATCY 1 cut(s) 165
MhlI GDGCHC 2 cut(s) 21, 129
MmeI TCCRAC 2 cut(s) 48, 359
MnlI CCTC 7 cut(s) 44, 61, 128, 178, 224, 241, 256
MseI TTAA 1 cut(s) 385
MvnI CGCG 1 cut(s) 203
MwoI GCNNNNNNNGC 1 cut(s) 348
NdeII GATC 4 cut(s) 43, 78, 105, 165
NmuCI GTSAC 2 cut(s) 285, 316
PkrI GCNGC 1 cut(s) 202
PpuMI RGGWCCY 1 cut(s) 211
Psp124BI GAGCTC 2 cut(s) 21, 129
Psp5II RGGWCCY 1 cut(s) 211
PspPI GGNCC 1 cut(s) 211
PspPPI RGGWCCY 1 cut(s) 211
PsuI RGATCY 1 cut(s) 165
RsaI GTAC 2 cut(s) 101, 242
RsaNI GTAC 2 cut(s) 100, 241
SacI GAGCTC 2 cut(s) 21, 129
SaqAI TTAA 1 cut(s) 385
SatI GCNGC 1 cut(s) 201
Sau3AI GATC 4 cut(s) 43, 78, 105, 165
Sau96I GGNCC 1 cut(s) 211
SduI GDGCHC 2 cut(s) 21, 129
SetI ASST 7 cut(s) 21, 54, 129, 183, 213, 252, 338
SinI GGWCC 1 cut(s) 211
SmlI CTYRAG 2 cut(s) 128, 215
SmoI CTYRAG 2 cut(s) 128, 215
SsiI CCGC 3 cut(s) 170, 201, 226
SspMI CTAG 1 cut(s) 95
SstI GAGCTC 2 cut(s) 21, 129
TaaI ACNGT 1 cut(s) 291
TaqI TCGA 4 cut(s) 42, 120, 162, 368
TatI WGTACW 1 cut(s) 99
TauI GCSGC 1 cut(s) 203
Tru1I TTAA 1 cut(s) 385
Tru9I TTAA 1 cut(s) 385
TscAI CASTG 2 cut(s) 161, 294
TseFI GTSAC 2 cut(s) 285, 316
Tsp45I GTSAC 2 cut(s) 285, 316
TspDTI ATGAA 2 cut(s) 47, 296
TspRI CASTG 2 cut(s) 161, 294
VpaK11BI GGWCC 1 cut(s) 211
XspI CTAG 1 cut(s) 95
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.