Rroxscaffold_3G00255740

Belongs to the Frigida family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
OG0019048
Physical Location & Seq
Forward (+)
50139079 .. 50141026
1948 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00255740.1

Sequence Viewer

Length: 258 bp
ATGAGAGAGATATCAGCCGGTGAAGAAAGAGCAGCTAGGGCGAATTCCAGCTCAAGCTGTGTAGCTTCTCGGCCTCCTACAAAACCTCCTCCAGAAATCGGAGGTCATCAAACCCTAGAGCGCGAGATCAAGGAGAGCCTTGACGAGCTTGAGCAGCGAGAGATCACCATCAACCAAAGCGTCGAGATCGCGCTAGTCAAGGTCAAGGAGACCAAGAAGGCAGCATTGAAGGTCCCGAAGAGAAGCCCACTCCGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Frigida

Protein Analysis

85

Amino Acids

9.4

Weight (kDa)

9.3

Isoelectric Point (pI)

69.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 2 cut(s) 123, 191
AcsI RAATTY 1 cut(s) 43
AfiI CCNNNNNNNGG 1 cut(s) 98
AgsI TTSAA 1 cut(s) 229
AluBI AGCT 5 cut(s) 35, 51, 57, 65, 148
AluI AGCT 5 cut(s) 35, 51, 57, 65, 148
Alw26I GTCTC 1 cut(s) 203
AoxI GGCC 1 cut(s) 71
ApeKI GCWGC 3 cut(s) 32, 154, 221
ApoI RAATTY 1 cut(s) 43
AspLEI GCGC 2 cut(s) 123, 193
AspS9I GGNCC 1 cut(s) 232
AsuHPI GGTGA 2 cut(s) 32, 157
AvaII GGWCC 1 cut(s) 232
BbvI GCAGC 3 cut(s) 44, 166, 233
BccI CCATC 1 cut(s) 176
BcoDI GTCTC 1 cut(s) 203
BfaI CTAG 3 cut(s) 36, 116, 194
BisI GCNGC 3 cut(s) 33, 155, 222
BlsI GCNGC 3 cut(s) 34, 156, 223
Bme18I GGWCC 1 cut(s) 232
BmgT120I GGNCC 1 cut(s) 232
BmiI GGNNCC 1 cut(s) 234
BpmI CTGGAG 1 cut(s) 75
BpuEI CTTGAG 2 cut(s) 37, 170
BsaBI GATNNNNATC 1 cut(s) 167
BsaI GGTCTC 1 cut(s) 203
BsaXI ACNNNNNCTCC 2 cut(s) 70, 100
Bsc4I CCNNNNNNNGG 1 cut(s) 98
Bse118I RCCGGY 1 cut(s) 17
Bse8I GATNNNNATC 1 cut(s) 167
BseJI GATNNNNATC 1 cut(s) 167
BseLI CCNNNNNNNGG 1 cut(s) 98
BseRI GAGGAG 1 cut(s) 78
BseXI GCAGC 3 cut(s) 44, 166, 233
Bsh1236I CGCG 2 cut(s) 123, 191
BshFI GGCC 1 cut(s) 73
BsiSI CCGG 1 cut(s) 18
BslFI GGGAC 1 cut(s) 218
BslI CCNNNNNNNGG 1 cut(s) 98
BsmAI GTCTC 1 cut(s) 203
BsmFI GGGAC 1 cut(s) 218
BsnI GGCC 1 cut(s) 73
Bso31I GGTCTC 1 cut(s) 203
Bsp143I GATC 3 cut(s) 126, 162, 186
BspANI GGCC 1 cut(s) 73
BspFNI CGCG 2 cut(s) 123, 191
BspLI GGNNCC 1 cut(s) 234
BspTNI GGTCTC 1 cut(s) 203
BsrFI RCCGGY 1 cut(s) 17
BssAI RCCGGY 1 cut(s) 17
BssMI GATC 3 cut(s) 126, 162, 186
Bst6I CTCTTC 1 cut(s) 233
BstFNI CGCG 2 cut(s) 123, 191
BstHHI GCGC 2 cut(s) 123, 193
BstKTI GATC 3 cut(s) 129, 165, 189
BstMAI GTCTC 1 cut(s) 203
BstMBI GATC 3 cut(s) 126, 162, 186
BstMWI GCNNNNNNNGC 2 cut(s) 38, 154
BstUI CGCG 2 cut(s) 123, 191
BstV1I GCAGC 3 cut(s) 44, 166, 233
BsuRI GGCC 1 cut(s) 73
CfoI GCGC 2 cut(s) 123, 193
Cfr10I RCCGGY 1 cut(s) 17
Cfr13I GGNCC 1 cut(s) 232
CseI GACGC 1 cut(s) 169
CviJI RGCY 9 cut(s) 17, 35, 51, 57, 65, 73, 138, 148, 246
CviKI_1 RGCY 9 cut(s) 17, 35, 51, 57, 65, 73, 138, 148, 246
DpnI GATC 3 cut(s) 128, 164, 188
DpnII GATC 3 cut(s) 126, 162, 186
Eam1104I CTCTTC 1 cut(s) 233
EarI CTCTTC 1 cut(s) 233
Eco31I GGTCTC 1 cut(s) 203
Eco32I GATATC 1 cut(s) 12
Eco47I GGWCC 1 cut(s) 232
EcoO109I RGGNCCY 1 cut(s) 232
EcoRI GAATTC 1 cut(s) 43
EcoRV GATATC 1 cut(s) 12
FaqI GGGAC 1 cut(s) 218
Fnu4HI GCNGC 3 cut(s) 33, 155, 222
Fsp4HI GCNGC 3 cut(s) 33, 155, 222
FspBI CTAG 3 cut(s) 36, 116, 194
GlaI GCGC 2 cut(s) 122, 192
GluI GCNGC 3 cut(s) 33, 155, 222
GsuI CTGGAG 1 cut(s) 75
HaeIII GGCC 1 cut(s) 73
HapII CCGG 1 cut(s) 18
HgaI GACGC 1 cut(s) 169
HhaI GCGC 2 cut(s) 123, 193
Hin6I GCGC 2 cut(s) 121, 191
HinP1I GCGC 2 cut(s) 121, 191
HpaII CCGG 1 cut(s) 18
HphI GGTGA 2 cut(s) 32, 157
Hpy188I TCNGA 2 cut(s) 101, 254
Hpy188III TCNNGA 3 cut(s) 92, 184, 235
Hpy99I CGWCG 1 cut(s) 185
HpyAV CCTTC 2 cut(s) 211, 223
HpyF10VI GCNNNNNNNGC 2 cut(s) 38, 154
HspAI GCGC 2 cut(s) 121, 191
Kzo9I GATC 3 cut(s) 126, 162, 186
LpnPI CCDG 3 cut(s) 31, 61, 105
Lsp1109I GCAGC 3 cut(s) 44, 166, 233
MaeI CTAG 3 cut(s) 36, 116, 194
MalI GATC 3 cut(s) 128, 164, 188
MboI GATC 3 cut(s) 126, 162, 186
MboII GAAGA 2 cut(s) 35, 250
MluCI AATT 1 cut(s) 43
MnlI CCTC 4 cut(s) 84, 95, 96, 99
MslI CAYNNNNRTG 1 cut(s) 253
MspI CCGG 1 cut(s) 18
MvnI CGCG 2 cut(s) 123, 191
MwoI GCNNNNNNNGC 2 cut(s) 38, 154
NdeII GATC 3 cut(s) 126, 162, 186
NlaIV GGNNCC 1 cut(s) 234
NmeAIII GCCGAG 1 cut(s) 49
PkrI GCNGC 3 cut(s) 34, 156, 223
PpuMI RGGWCCY 1 cut(s) 232
Psp5II RGGWCCY 1 cut(s) 232
PspN4I GGNNCC 1 cut(s) 234
PspPI GGNCC 1 cut(s) 232
PspPPI RGGWCCY 1 cut(s) 232
RseI CAYNNNNRTG 1 cut(s) 253
SatI GCNGC 3 cut(s) 33, 155, 222
Sau3AI GATC 3 cut(s) 126, 162, 186
Sau96I GGNCC 1 cut(s) 232
SetI ASST 9 cut(s) 37, 53, 59, 67, 88, 106, 150, 204, 234
SinI GGWCC 1 cut(s) 232
SmiMI CAYNNNNRTG 1 cut(s) 253
SmlI CTYRAG 2 cut(s) 52, 149
SmoI CTYRAG 2 cut(s) 52, 149
Sse9I AATT 1 cut(s) 43
SspMI CTAG 3 cut(s) 36, 116, 194
TaqI TCGA 1 cut(s) 183
TasI AATT 1 cut(s) 43
TseI GCWGC 3 cut(s) 32, 154, 221
VpaK11BI GGWCC 1 cut(s) 232
XapI RAATTY 1 cut(s) 43
XspI CTAG 3 cut(s) 36, 116, 194
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.