Rmu_sc0001940.1_g000048

PLAC8 family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001940.1
Physical Location & Seq
Forward (+)
182296 .. 182919
624 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001940.1_g000048.1.cds

Sequence Viewer

Length: 414 bp
atgagttcagacaactccatccgaaactccgatatggctcaatccgaaaagcaacctccccaaggacaatggtccactgcccttttcgattgtttggaggatcgttcaaattgtcttttcacttgcttttgtccatgcatggcctttggacgaattgcggagattgttgacagaggaactacatcatgtgcggtcgccggcacgatctaccatgttctggcctctgtaggctgtggatggctttatgctggttcgtatagaaccaaactgcgaggacacttctcactaccagcagcgccatgccatgatcttttggttcatagcttctgctgtgtttgttctatttgtcaagagtatagagaactcaaaaatcatggaattgatccctccattggtaactacactcttaattaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

137

Amino Acids

15.08

Weight (kDa)

6.16

Isoelectric Point (pI)

43.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016501)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G58320
fragaria_vesca FvH4_4g27730
prunus_persica Prupe.1G307500_v2.0.a1
rosa_chinensis RchiOBHm_Chr4g0435591
rosa_laevigata RLG00000006579
rosa_multiflora Rmu_sc0001940.1_g000048 Rmu_sc0006697.1_g000001
rosa_roxburghii Rroxscaffold_5G00376820
rosa_rugosa Rorug04G0286900
rosa_samantha Rh4AG342300 Rh4BG350500 Rh4CG365200 Rh4DG344900
rosa_wichuraiana Rw4G029860

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 217
AciI CCGC 2 cut(s) 158, 191
AclWI GGATC 2 cut(s) 108, 377
AfiI CCNNNNNNNGG 3 cut(s) 62, 217, 392
AgsI TTSAA 1 cut(s) 108
AluBI AGCT 1 cut(s) 324
AluI AGCT 1 cut(s) 324
AlwI GGATC 2 cut(s) 108, 377
AoxI GGCC 2 cut(s) 141, 219
ApeKI GCWGC 1 cut(s) 293
AspLEI GCGC 1 cut(s) 298
AspS9I GGNCC 1 cut(s) 72
AvaII GGWCC 1 cut(s) 72
BbvI GCAGC 1 cut(s) 305
BccI CCATC 2 cut(s) 26, 231
BfmI CTRYAG 1 cut(s) 225
BfoI RGCGCY 1 cut(s) 299
BisI GCNGC 1 cut(s) 294
BlsI GCNGC 1 cut(s) 295
Bme18I GGWCC 1 cut(s) 72
BmgT120I GGNCC 1 cut(s) 72
BoxI GACNNNNGTC 1 cut(s) 70
BsaJI CCNNGG 1 cut(s) 61
Bsc4I CCNNNNNNNGG 3 cut(s) 62, 217, 392
Bse118I RCCGGY 1 cut(s) 197
BseDI CCNNGG 1 cut(s) 61
BseGI GGATG 2 cut(s) 18, 242
BseLI CCNNNNNNNGG 3 cut(s) 62, 217, 392
BseXI GCAGC 1 cut(s) 305
Bsh1285I CGRYCG 1 cut(s) 195
BshFI GGCC 2 cut(s) 143, 221
BsiEI CGRYCG 1 cut(s) 195
BsiSI CCGG 1 cut(s) 198
BslI CCNNNNNNNGG 3 cut(s) 62, 217, 392
BsnI GGCC 2 cut(s) 143, 221
Bsp143I GATC 4 cut(s) 100, 204, 307, 382
BspACI CCGC 2 cut(s) 158, 191
BspANI GGCC 2 cut(s) 143, 221
BspPI GGATC 2 cut(s) 108, 377
BsrFI RCCGGY 1 cut(s) 197
BssAI RCCGGY 1 cut(s) 197
BssECI CCNNGG 1 cut(s) 61
BssMI GATC 4 cut(s) 100, 204, 307, 382
BssT1I CCWWGG 1 cut(s) 61
BstC8I GCNNGC 1 cut(s) 199
BstENI CCTNNNNNAGG 1 cut(s) 60
BstF5I GGATG 2 cut(s) 18, 242
BstH2I RGCGCY 1 cut(s) 299
BstHHI GCGC 1 cut(s) 298
BstKTI GATC 4 cut(s) 103, 207, 310, 385
BstMBI GATC 4 cut(s) 100, 204, 307, 382
BstMCI CGRYCG 1 cut(s) 195
BstPAI GACNNNNGTC 1 cut(s) 70
BstSFI CTRYAG 1 cut(s) 225
BstV1I GCAGC 1 cut(s) 305
BsuRI GGCC 2 cut(s) 143, 221
BtsCI GGATG 2 cut(s) 18, 242
BtsI GCAGTG 1 cut(s) 75
BtsIMutI CAGTG 1 cut(s) 75
Cac8I GCNNGC 1 cut(s) 199
CfoI GCGC 1 cut(s) 298
Cfr10I RCCGGY 1 cut(s) 197
Cfr13I GGNCC 1 cut(s) 72
CviAII CATG 7 cut(s) 135, 139, 186, 212, 300, 305, 374
CviJI RGCY 6 cut(s) 38, 143, 221, 231, 241, 324
CviKI_1 RGCY 6 cut(s) 38, 143, 221, 231, 241, 324
DpnI GATC 4 cut(s) 102, 206, 309, 384
DpnII GATC 4 cut(s) 100, 204, 307, 382
Eco130I CCWWGG 1 cut(s) 61
Eco47I GGWCC 1 cut(s) 72
EcoNI CCTNNNNNAGG 1 cut(s) 60
EcoT14I CCWWGG 1 cut(s) 61
EcoT22I ATGCAT 1 cut(s) 140
ErhI CCWWGG 1 cut(s) 61
FaeI CATG 7 cut(s) 138, 142, 189, 215, 303, 308, 377
FatI CATG 7 cut(s) 134, 138, 185, 211, 299, 304, 373
Fnu4HI GCNGC 1 cut(s) 294
FokI GGATG 2 cut(s) 5, 249
Fsp4HI GCNGC 1 cut(s) 294
GlaI GCGC 1 cut(s) 297
GluI GCNGC 1 cut(s) 294
HaeII RGCGCY 1 cut(s) 299
HaeIII GGCC 2 cut(s) 143, 221
HapII CCGG 1 cut(s) 198
HhaI GCGC 1 cut(s) 298
Hin1II CATG 7 cut(s) 138, 142, 189, 215, 303, 308, 377
Hin6I GCGC 1 cut(s) 296
HinP1I GCGC 1 cut(s) 296
HincII GTYRAC 1 cut(s) 169
HindII GTYRAC 1 cut(s) 169
HpaII CCGG 1 cut(s) 198
Hpy166II GTNNAC 2 cut(s) 75, 169
Hpy188I TCNGA 4 cut(s) 10, 23, 31, 46
Hpy188III TCNNGA 1 cut(s) 350
Hpy8I GTNNAC 2 cut(s) 75, 169
HpyCH4V TGCA 1 cut(s) 138
Hsp92II CATG 7 cut(s) 138, 142, 189, 215, 303, 308, 377
HspAI GCGC 1 cut(s) 296
KroI GCCGGC 1 cut(s) 197
KroNI GCCGGC 1 cut(s) 199
Kzo9I GATC 4 cut(s) 100, 204, 307, 382
LpnPI CCDG 4 cut(s) 203, 211, 234, 303
Lsp1109I GCAGC 1 cut(s) 305
MaeIII GTNAC 1 cut(s) 395
MalI GATC 4 cut(s) 102, 206, 309, 384
MboI GATC 4 cut(s) 100, 204, 307, 382
MluCI AATT 4 cut(s) 109, 153, 378, 409
MnlI CCTC 6 cut(s) 66, 91, 167, 232, 266, 397
Mph1103I ATGCAT 1 cut(s) 140
MroNI GCCGGC 1 cut(s) 197
MseI TTAA 2 cut(s) 408, 412
MspI CCGG 1 cut(s) 198
NaeI GCCGGC 1 cut(s) 199
NdeII GATC 4 cut(s) 100, 204, 307, 382
NgoMIV GCCGGC 1 cut(s) 197
NlaIII CATG 7 cut(s) 138, 142, 189, 215, 303, 308, 377
NsiI ATGCAT 1 cut(s) 140
PacI TTAATTAA 1 cut(s) 412
PdiI GCCGGC 1 cut(s) 199
PflMI CCANNNNNTGG 1 cut(s) 217
PkrI GCNGC 1 cut(s) 295
PshAI GACNNNNGTC 1 cut(s) 70
PspPI GGNCC 1 cut(s) 72
SaqAI TTAA 2 cut(s) 408, 412
SatI GCNGC 1 cut(s) 294
Sau3AI GATC 4 cut(s) 100, 204, 307, 382
Sau96I GGNCC 1 cut(s) 72
SetI ASST 2 cut(s) 58, 326
SfcI CTRYAG 1 cut(s) 225
SinI GGWCC 1 cut(s) 72
Sse9I AATT 4 cut(s) 109, 153, 378, 409
SsiI CCGC 2 cut(s) 158, 191
StyI CCWWGG 1 cut(s) 61
TaqI TCGA 1 cut(s) 87
TasI AATT 4 cut(s) 109, 153, 378, 409
Tru1I TTAA 2 cut(s) 408, 412
Tru9I TTAA 2 cut(s) 408, 412
TscAI CASTG 1 cut(s) 82
TseI GCWGC 1 cut(s) 293
TspDTI ATGAA 1 cut(s) 308
TspRI CASTG 1 cut(s) 82
Van91I CCANNNNNTGG 1 cut(s) 217
VpaK11BI GGWCC 1 cut(s) 72
XagI CCTNNNNNAGG 1 cut(s) 60
Zsp2I ATGCAT 1 cut(s) 140
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.