Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0006697.1

Orthogroup ID

OG0016501

Physical Location & Seq

Genomic Coordinates Reverse (-)

686 .. 1309

Gene Structure 624 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0006697.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 414 bp

atgagttcagacaactccatccgaaactgcgatatggctcaatccgaaaagcaacctccccaaggacaatggtccactgcccttttcgattgtttggaggatcgttcaaattgtcttttcacttgcttttgtccatgcatggcctttggacgaattgcggagattgttgacagaggaactacatcatgtgcggtcgccggcacgatctaccatgttctggcctctgtaggctgtggatggctttatgctggttcctatagaaccaaactgcgaggacacttctcactaccagcagcgccatgccatgatcttttggttcatagcttctgctgtgtttgttctatttgtcaagagtatagagaactcaaaaatcatggaattgatccctccattggtaactacactcttaattaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PLAC8

Protein Analysis

137

Amino Acids

15.1

Weight (kDa)

6.16

Isoelectric Point (pI)

44.73

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016501)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G58320
fragaria_vesca	FvH4_4g27730
prunus_persica	Prupe.1G307500_v2.0.a1
rosa_chinensis	RchiOBHm_Chr4g0435591
rosa_laevigata	RLG00000006579
rosa_multiflora	Rmu_sc0001940.1_g000048 Rmu_sc0006697.1_g000001
rosa_roxburghii	Rroxscaffold_5G00376820
rosa_rugosa	Rorug04G0286900
rosa_samantha	Rh4AG342300 Rh4BG350500 Rh4CG365200 Rh4DG344900
rosa_wichuraiana	Rw4G029860

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	217
AciI	CCGC	2 cut(s)	158, 191
AclWI	GGATC	2 cut(s)	108, 377
AfiI	CCNNNNNNNGG	3 cut(s)	62, 217, 392
AgsI	TTSAA	1 cut(s)	108
AluBI	AGCT	1 cut(s)	324
AluI	AGCT	1 cut(s)	324
AlwI	GGATC	2 cut(s)	108, 377
AoxI	GGCC	2 cut(s)	141, 219
ApeKI	GCWGC	1 cut(s)	293
AspLEI	GCGC	1 cut(s)	298
AspS9I	GGNCC	1 cut(s)	72
AvaII	GGWCC	1 cut(s)	72
BbvI	GCAGC	1 cut(s)	305
BccI	CCATC	2 cut(s)	26, 231
BfmI	CTRYAG	2 cut(s)	225, 256
BfoI	RGCGCY	1 cut(s)	299
BisI	GCNGC	1 cut(s)	294
BlsI	GCNGC	1 cut(s)	295
Bme18I	GGWCC	1 cut(s)	72
BmgT120I	GGNCC	1 cut(s)	72
BmiI	GGNNCC	1 cut(s)	253
BoxI	GACNNNNGTC	1 cut(s)	70
BsaJI	CCNNGG	1 cut(s)	61
Bsc4I	CCNNNNNNNGG	3 cut(s)	62, 217, 392
Bse118I	RCCGGY	1 cut(s)	197
BseDI	CCNNGG	1 cut(s)	61
BseGI	GGATG	2 cut(s)	18, 242
BseLI	CCNNNNNNNGG	3 cut(s)	62, 217, 392
BseXI	GCAGC	1 cut(s)	305
Bsh1285I	CGRYCG	1 cut(s)	195
BshFI	GGCC	2 cut(s)	143, 221
BsiEI	CGRYCG	1 cut(s)	195
BsiSI	CCGG	1 cut(s)	198
BslI	CCNNNNNNNGG	3 cut(s)	62, 217, 392
BsnI	GGCC	2 cut(s)	143, 221
Bsp143I	GATC	4 cut(s)	100, 204, 307, 382
BspACI	CCGC	2 cut(s)	158, 191
BspANI	GGCC	2 cut(s)	143, 221
BspLI	GGNNCC	1 cut(s)	253
BspPI	GGATC	2 cut(s)	108, 377
BsrFI	RCCGGY	1 cut(s)	197
BssAI	RCCGGY	1 cut(s)	197
BssECI	CCNNGG	1 cut(s)	61
BssMI	GATC	4 cut(s)	100, 204, 307, 382
BssT1I	CCWWGG	1 cut(s)	61
BstC8I	GCNNGC	1 cut(s)	199
BstENI	CCTNNNNNAGG	1 cut(s)	60
BstF5I	GGATG	2 cut(s)	18, 242
BstH2I	RGCGCY	1 cut(s)	299
BstHHI	GCGC	1 cut(s)	298
BstKTI	GATC	4 cut(s)	103, 207, 310, 385
BstMBI	GATC	4 cut(s)	100, 204, 307, 382
BstMCI	CGRYCG	1 cut(s)	195
BstPAI	GACNNNNGTC	1 cut(s)	70
BstSFI	CTRYAG	2 cut(s)	225, 256
BstV1I	GCAGC	1 cut(s)	305
BsuRI	GGCC	2 cut(s)	143, 221
BtsCI	GGATG	2 cut(s)	18, 242
BtsI	GCAGTG	1 cut(s)	75
BtsIMutI	CAGTG	1 cut(s)	75
Cac8I	GCNNGC	1 cut(s)	199
CfoI	GCGC	1 cut(s)	298
Cfr10I	RCCGGY	1 cut(s)	197
Cfr13I	GGNCC	1 cut(s)	72
CviAII	CATG	7 cut(s)	135, 139, 186, 212, 300, 305, 374
CviJI	RGCY	6 cut(s)	38, 143, 221, 231, 241, 324
CviKI_1	RGCY	6 cut(s)	38, 143, 221, 231, 241, 324
DpnI	GATC	4 cut(s)	102, 206, 309, 384
DpnII	GATC	4 cut(s)	100, 204, 307, 382
Eco130I	CCWWGG	1 cut(s)	61
Eco47I	GGWCC	1 cut(s)	72
EcoNI	CCTNNNNNAGG	1 cut(s)	60
EcoT14I	CCWWGG	1 cut(s)	61
EcoT22I	ATGCAT	1 cut(s)	140
ErhI	CCWWGG	1 cut(s)	61
FaeI	CATG	7 cut(s)	138, 142, 189, 215, 303, 308, 377
FatI	CATG	7 cut(s)	134, 138, 185, 211, 299, 304, 373
Fnu4HI	GCNGC	1 cut(s)	294
FokI	GGATG	2 cut(s)	5, 249
Fsp4HI	GCNGC	1 cut(s)	294
GlaI	GCGC	1 cut(s)	297
GluI	GCNGC	1 cut(s)	294
HaeII	RGCGCY	1 cut(s)	299
HaeIII	GGCC	2 cut(s)	143, 221
HapII	CCGG	1 cut(s)	198
HhaI	GCGC	1 cut(s)	298
Hin1II	CATG	7 cut(s)	138, 142, 189, 215, 303, 308, 377
Hin6I	GCGC	1 cut(s)	296
HinP1I	GCGC	1 cut(s)	296
HincII	GTYRAC	1 cut(s)	169
HindII	GTYRAC	1 cut(s)	169
HpaII	CCGG	1 cut(s)	198
Hpy166II	GTNNAC	2 cut(s)	75, 169
Hpy188I	TCNGA	3 cut(s)	10, 23, 46
Hpy188III	TCNNGA	1 cut(s)	350
Hpy8I	GTNNAC	2 cut(s)	75, 169
HpyCH4V	TGCA	1 cut(s)	138
Hsp92II	CATG	7 cut(s)	138, 142, 189, 215, 303, 308, 377
HspAI	GCGC	1 cut(s)	296
KroI	GCCGGC	1 cut(s)	197
KroNI	GCCGGC	1 cut(s)	199
Kzo9I	GATC	4 cut(s)	100, 204, 307, 382
LpnPI	CCDG	4 cut(s)	203, 211, 234, 303
Lsp1109I	GCAGC	1 cut(s)	305
MaeIII	GTNAC	1 cut(s)	395
MalI	GATC	4 cut(s)	102, 206, 309, 384
MboI	GATC	4 cut(s)	100, 204, 307, 382
MluCI	AATT	4 cut(s)	109, 153, 378, 409
MnlI	CCTC	6 cut(s)	66, 91, 167, 232, 266, 397
Mph1103I	ATGCAT	1 cut(s)	140
MroNI	GCCGGC	1 cut(s)	197
MseI	TTAA	2 cut(s)	408, 412
MspI	CCGG	1 cut(s)	198
NaeI	GCCGGC	1 cut(s)	199
NdeII	GATC	4 cut(s)	100, 204, 307, 382
NgoMIV	GCCGGC	1 cut(s)	197
NlaIII	CATG	7 cut(s)	138, 142, 189, 215, 303, 308, 377
NlaIV	GGNNCC	1 cut(s)	253
NsiI	ATGCAT	1 cut(s)	140
PacI	TTAATTAA	1 cut(s)	412
PdiI	GCCGGC	1 cut(s)	199
PflMI	CCANNNNNTGG	1 cut(s)	217
PkrI	GCNGC	1 cut(s)	295
PshAI	GACNNNNGTC	1 cut(s)	70
PspN4I	GGNNCC	1 cut(s)	253
PspPI	GGNCC	1 cut(s)	72
SaqAI	TTAA	2 cut(s)	408, 412
SatI	GCNGC	1 cut(s)	294
Sau3AI	GATC	4 cut(s)	100, 204, 307, 382
Sau96I	GGNCC	1 cut(s)	72
SetI	ASST	2 cut(s)	58, 326
SfcI	CTRYAG	2 cut(s)	225, 256
SinI	GGWCC	1 cut(s)	72
Sse9I	AATT	4 cut(s)	109, 153, 378, 409
SsiI	CCGC	2 cut(s)	158, 191
StyI	CCWWGG	1 cut(s)	61
TaqI	TCGA	1 cut(s)	87
TasI	AATT	4 cut(s)	109, 153, 378, 409
Tru1I	TTAA	2 cut(s)	408, 412
Tru9I	TTAA	2 cut(s)	408, 412
TscAI	CASTG	1 cut(s)	82
TseI	GCWGC	1 cut(s)	293
TspDTI	ATGAA	1 cut(s)	308
TspRI	CASTG	1 cut(s)	82
Van91I	CCANNNNNTGG	1 cut(s)	217
VpaK11BI	GGWCC	1 cut(s)	72
XagI	CCTNNNNNAGG	1 cut(s)	60
Zsp2I	ATGCAT	1 cut(s)	140

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.