Rmu_sc0002174.1_g000002

f-box protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002174.1
OG0018343
Physical Location & Seq
Forward (+)
7929 .. 8734
806 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002174.1_g000002.1.cds

Sequence Viewer

Length: 702 bp
atgaacctgcctacgatccgtagatgcagttctgtccataacattgttgaaaagttcatcaagaagcgttacagaaagaagttggacatgttgacgaatgaagaagatgaacaagaagaggaatatctgcaagctaggcaggttaaaagacgaattttccctgaagtagaagctgaacttgcccggctgatgatacgaagaggaagaggaagagatcacatgggtcaacgacgaaagactttggagcacattggcaaggaaatcaaagccttgaggataactacaagacaagaatatggtacgagttgcaatatagatttcgcaagtcttcctccagatattgtgcttcttattctggataagttgttagaacccattgaccatgctcgttttgctgtcgtctgtattgctgtcgtctgtaaggaatggcaatctcttgcaaaacagtataattgtgaaacgcagccctgggttaaggtcctccctcccatgctatggatccctacccaatctcatggctccgatgacccaatgaccatgctttacagcttgtctgaaagaaaaatctacagaaatatgaagttgccagtgcctcgtgatgataggatctattgtggttatggatggatggctaagtatcggtatctaaataagtcctcagattattatgctagtctagcaataactctcagtctctcatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF295 F-box F-box-like

Protein Analysis

233

Amino Acids

27.47

Weight (kDa)

9.31

Isoelectric Point (pI)

51.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018343)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g06764 FvH4_1g06765
rosa_laevigata RLG00000016319
rosa_multiflora Rmu_sc0002174.1_g000002 Rmu_sc0002503.1_g000018 Rmu_sc0004296.1_g000013
rosa_samantha Rh2AG073000 Rh2BG073700 Rh2CG074800 Rh2DG071800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 2 cut(s) 15, 130
AccB7I CCANNNNNTGG 1 cut(s) 495
AclWI GGATC 4 cut(s) 10, 493, 506, 614
AcsI RAATTY 1 cut(s) 153
AcuI CTGAAG 1 cut(s) 183
AfaI GTAC 1 cut(s) 301
AfiI CCNNNNNNNGG 1 cut(s) 495
AflIII ACRYGT 1 cut(s) 87
AgsI TTSAA 1 cut(s) 50
AjnI CCWGG 1 cut(s) 467
AluBI AGCT 3 cut(s) 134, 173, 549
AluI AGCT 3 cut(s) 134, 173, 549
Alw21I GWGCWC 1 cut(s) 249
Alw26I GTCTC 1 cut(s) 698
AlwI GGATC 4 cut(s) 10, 493, 506, 614
ApeKI GCWGC 1 cut(s) 463
ApoI RAATTY 1 cut(s) 153
AspS9I GGNCC 1 cut(s) 478
AsuC2I CCSGG 1 cut(s) 184
AvaII GGWCC 1 cut(s) 478
BamHI GGATCC 1 cut(s) 498
BauI CACGAG 1 cut(s) 594
BbsI GAAGAC 1 cut(s) 320
Bbv12I GWGCWC 1 cut(s) 249
BbvI GCAGC 1 cut(s) 475
BccI CCATC 2 cut(s) 618, 622
BciT130I CCWGG 1 cut(s) 469
BcnI CCSGG 1 cut(s) 184
BcoDI GTCTC 1 cut(s) 698
BfaI CTAG 3 cut(s) 135, 672, 677
BfmI CTRYAG 1 cut(s) 568
BfuAI ACCTGC 2 cut(s) 15, 130
BisI GCNGC 1 cut(s) 464
BlsI GCNGC 1 cut(s) 465
Bme1390I CCNGG 2 cut(s) 184, 469
Bme18I GGWCC 1 cut(s) 478
BmgT120I GGNCC 1 cut(s) 478
BmiI GGNNCC 2 cut(s) 500, 520
BmrFI CCNGG 2 cut(s) 184, 469
BmsI GCATC 1 cut(s) 14
BpiI GAAGAC 1 cut(s) 320
BpmI CTGGAG 1 cut(s) 318
BpuEI CTTGAG 1 cut(s) 292
BpuMI CCSGG 1 cut(s) 184
BsaJI CCNNGG 2 cut(s) 467, 468
Bsc4I CCNNNNNNNGG 1 cut(s) 495
Bse1I ACTGG 1 cut(s) 587
BseBI CCWGG 1 cut(s) 469
BseDI CCNNGG 2 cut(s) 467, 468
BseGI GGATG 2 cut(s) 629, 633
BseLI CCNNNNNNNGG 1 cut(s) 495
BseMII CTCAG 1 cut(s) 672
BseNI ACTGG 1 cut(s) 587
BseXI GCAGC 1 cut(s) 475
BsiHKAI GWGCWC 1 cut(s) 249
BsiSI CCGG 1 cut(s) 184
BslI CCNNNNNNNGG 1 cut(s) 495
BsmAI GTCTC 1 cut(s) 698
Bsp1286I GDGCHC 1 cut(s) 249
Bsp143I GATC 4 cut(s) 15, 214, 498, 606
BspCNI CTCAG 2 cut(s) 671, 702
BspHI TCATGA 1 cut(s) 698
BspLI GGNNCC 2 cut(s) 500, 520
BspMI ACCTGC 2 cut(s) 15, 130
BspPI GGATC 4 cut(s) 10, 493, 506, 614
BsrI ACTGG 1 cut(s) 587
BssECI CCNNGG 2 cut(s) 467, 468
BssMI GATC 4 cut(s) 15, 214, 498, 606
BssSI CACGAG 1 cut(s) 594
Bst2BI CACGAG 1 cut(s) 594
Bst2UI CCWGG 1 cut(s) 469
Bst4CI ACNGT 1 cut(s) 447
Bst6I CTCTTC 4 cut(s) 111, 193, 199, 205
BstC8I GCNNGC 1 cut(s) 132
BstDEI CTNAG 3 cut(s) 633, 658, 689
BstF5I GGATG 2 cut(s) 629, 633
BstKTI GATC 4 cut(s) 18, 217, 501, 609
BstMAI GTCTC 1 cut(s) 698
BstMBI GATC 4 cut(s) 15, 214, 498, 606
BstMWI GCNNNNNNNGC 4 cut(s) 136, 179, 392, 677
BstNI CCWGG 1 cut(s) 469
BstNSI RCATGY 1 cut(s) 91
BstSCI CCNGG 2 cut(s) 182, 467
BstSFI CTRYAG 1 cut(s) 568
BstV1I GCAGC 1 cut(s) 475
BstV2I GAAGAC 1 cut(s) 320
BstX2I RGATCY 2 cut(s) 498, 606
BstXI CCANNNNNNTGG 1 cut(s) 515
BstYI RGATCY 2 cut(s) 498, 606
BtsCI GGATG 2 cut(s) 629, 633
BtsIMutI CAGTG 1 cut(s) 594
BveI ACCTGC 2 cut(s) 15, 130
Cac8I GCNNGC 1 cut(s) 132
CciI TCATGA 1 cut(s) 698
Cfr13I GGNCC 1 cut(s) 478
Csp6I GTAC 1 cut(s) 300
CviAII CATG 7 cut(s) 88, 220, 383, 490, 515, 538, 699
CviJI RGCY 8 cut(s) 134, 173, 187, 269, 466, 519, 549, 632
CviKI_1 RGCY 8 cut(s) 134, 173, 187, 269, 466, 519, 549, 632
CviQI GTAC 1 cut(s) 300
DdeI CTNAG 3 cut(s) 633, 658, 689
DpnI GATC 4 cut(s) 17, 216, 500, 608
DpnII GATC 4 cut(s) 15, 214, 498, 606
Eam1104I CTCTTC 4 cut(s) 111, 193, 199, 205
EarI CTCTTC 4 cut(s) 111, 193, 199, 205
Eco47I GGWCC 1 cut(s) 478
Eco57I CTGAAG 1 cut(s) 183
EcoO109I RGGNCCY 1 cut(s) 478
EcoRII CCWGG 1 cut(s) 467
FaeI CATG 7 cut(s) 91, 223, 386, 493, 518, 541, 702
FalI AAGNNNNNCTT 2 cut(s) 162, 194
FatI CATG 7 cut(s) 87, 219, 382, 489, 514, 537, 698
Fnu4HI GCNGC 1 cut(s) 464
FokI GGATG 2 cut(s) 636, 640
Fsp4HI GCNGC 1 cut(s) 464
FspBI CTAG 3 cut(s) 135, 672, 677
GluI GCNGC 1 cut(s) 464
GsuI CTGGAG 1 cut(s) 318
HapII CCGG 1 cut(s) 184
Hin1II CATG 7 cut(s) 91, 223, 386, 493, 518, 541, 702
HincII GTYRAC 2 cut(s) 93, 227
HindII GTYRAC 2 cut(s) 93, 227
HpaII CCGG 1 cut(s) 184
Hpy166II GTNNAC 2 cut(s) 93, 227
Hpy188I TCNGA 3 cut(s) 523, 556, 661
Hpy188III TCNNGA 5 cut(s) 61, 335, 356, 596, 699
Hpy8I GTNNAC 2 cut(s) 93, 227
Hpy99I CGWCG 1 cut(s) 234
HpyCH4III ACNGT 1 cut(s) 447
HpyCH4V TGCA 4 cut(s) 27, 130, 309, 440
HpyF10VI GCNNNNNNNGC 4 cut(s) 136, 179, 392, 677
HpyF3I CTNAG 3 cut(s) 633, 658, 689
Hsp92II CATG 7 cut(s) 91, 223, 386, 493, 518, 541, 702
Kzo9I GATC 4 cut(s) 15, 214, 498, 606
LmnI GCTCC 2 cut(s) 244, 524
LpnPI CCDG 9 cut(s) 20, 125, 174, 197, 341, 348, 454, 481, 600
Lsp1109I GCAGC 1 cut(s) 475
LweI GCATC 1 cut(s) 14
MaeI CTAG 3 cut(s) 135, 672, 677
MaeIII GTNAC 1 cut(s) 68
MalI GATC 4 cut(s) 17, 216, 500, 608
MboI GATC 4 cut(s) 15, 214, 498, 606
MboII GAAGA 7 cut(s) 113, 116, 128, 210, 216, 222, 320
MflI RGATCY 2 cut(s) 498, 606
MhlI GDGCHC 1 cut(s) 249
MluCI AATT 2 cut(s) 153, 451
MmeI TCCRAC 1 cut(s) 63
MnlI CCTC 9 cut(s) 112, 194, 200, 267, 342, 491, 495, 603, 667
MseI TTAA 2 cut(s) 144, 474
MspI CCGG 1 cut(s) 184
MspR9I CCNGG 2 cut(s) 184, 469
MvaI CCWGG 1 cut(s) 469
MwoI GCNNNNNNNGC 4 cut(s) 136, 179, 392, 677
NciI CCSGG 1 cut(s) 184
NdeII GATC 4 cut(s) 15, 214, 498, 606
NlaIII CATG 7 cut(s) 91, 223, 386, 493, 518, 541, 702
NlaIV GGNNCC 2 cut(s) 500, 520
NspI RCATGY 1 cut(s) 91
PagI TCATGA 1 cut(s) 698
PasI CCCWGGG 1 cut(s) 468
PciI ACATGT 1 cut(s) 87
PflMI CCANNNNNTGG 1 cut(s) 495
PkrI GCNGC 1 cut(s) 465
PpuMI RGGWCCY 1 cut(s) 478
PscI ACATGT 1 cut(s) 87
Psp5II RGGWCCY 1 cut(s) 478
Psp6I CCWGG 1 cut(s) 467
PspGI CCWGG 1 cut(s) 467
PspN4I GGNNCC 2 cut(s) 500, 520
PspPI GGNCC 1 cut(s) 478
PspPPI RGGWCCY 1 cut(s) 478
PsrI GAACNNNNNNTAC 2 cut(s) 13, 45
PsuI RGATCY 2 cut(s) 498, 606
RsaI GTAC 1 cut(s) 301
RsaNI GTAC 1 cut(s) 300
SaqAI TTAA 2 cut(s) 144, 474
SatI GCNGC 1 cut(s) 464
Sau3AI GATC 4 cut(s) 15, 214, 498, 606
Sau96I GGNCC 1 cut(s) 478
ScrFI CCNGG 2 cut(s) 184, 469
SduI GDGCHC 1 cut(s) 249
SetI ASST 6 cut(s) 9, 136, 144, 175, 480, 551
SfaNI GCATC 1 cut(s) 14
SfcI CTRYAG 1 cut(s) 568
SinI GGWCC 1 cut(s) 478
SmlI CTYRAG 1 cut(s) 271
SmoI CTYRAG 1 cut(s) 271
Sse9I AATT 2 cut(s) 153, 451
SspMI CTAG 3 cut(s) 135, 672, 677
StyD4I CCNGG 2 cut(s) 182, 467
TaaI ACNGT 1 cut(s) 447
TasI AATT 2 cut(s) 153, 451
Tru1I TTAA 2 cut(s) 144, 474
Tru9I TTAA 2 cut(s) 144, 474
TscAI CASTG 1 cut(s) 594
TseI GCWGC 1 cut(s) 463
TspDTI ATGAA 5 cut(s) 17, 46, 114, 123, 593
TspGWI ACGGA 1 cut(s) 8
TspRI CASTG 1 cut(s) 594
Van91I CCANNNNNTGG 1 cut(s) 495
VpaK11BI GGWCC 1 cut(s) 478
XapI RAATTY 1 cut(s) 153
XceI RCATGY 1 cut(s) 91
XspI CTAG 3 cut(s) 135, 672, 677
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.