Rmu_sc0002503.1_g000018

f-box protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002503.1
OG0018343
Physical Location & Seq
Forward (+)
68845 .. 69651
807 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002503.1_g000018.1.cds

Sequence Viewer

Length: 732 bp
atgaacctgcctacgatccgtagatgcagttctgtccataacatcgttgaaaagttcatcaagaagcgttacagaaagaagttggacatgttgacgaatgaagaagatgaacaagaagaggaatatctgcaagctaggcaggttaaaagacgaattttccctgaagacacagcagccatacaaaagtacacaacgaaacgaaagttaacgaatttacatgaagacgaagaggaagaggaagagatcacatgggtcaaacgacgaaagactttggagcacattggcaaggaaatcaaagccttgaggataactacaagacaagaatatggtacgagttgcaatatagatttcgcaagtcttcctccagatattgtgcttcttattctggataagttgttagaacccattgaccatgctcgttttgctgtcgtctgtattgctgtcgtctgtaaggaatggcaatctcttgcaaaacagtataattgtgaaacgcagccctgggttaaggtcctccctcccatgctatggatccctacccaatctcatggctccgatgacccaatgaccatgctttacagcttgtctgaaagaaaaatctacagaaatatgaagttgccagtgcctcgtgatgataggatctattgtggttatggatggatggctaagtatcggtatctaaataagtcctcagattattatgctagtctagcaataactctcagtctctcatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF295 F-box F-box-like

Protein Analysis

243

Amino Acids

28.77

Weight (kDa)

8.6

Isoelectric Point (pI)

56.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018343)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g06764 FvH4_1g06765
rosa_laevigata RLG00000016319
rosa_multiflora Rmu_sc0002174.1_g000002 Rmu_sc0002503.1_g000018 Rmu_sc0004296.1_g000013
rosa_samantha Rh2AG073000 Rh2BG073700 Rh2CG074800 Rh2DG071800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 2 cut(s) 15, 130
AccB7I CCANNNNNTGG 1 cut(s) 525
AclWI GGATC 4 cut(s) 10, 523, 536, 644
AcsI RAATTY 2 cut(s) 153, 211
AcuI CTGAAG 1 cut(s) 183
AfaI GTAC 2 cut(s) 188, 331
AfiI CCNNNNNNNGG 1 cut(s) 525
AflIII ACRYGT 1 cut(s) 87
AgsI TTSAA 1 cut(s) 50
AjnI CCWGG 1 cut(s) 497
AluBI AGCT 2 cut(s) 134, 579
AluI AGCT 2 cut(s) 134, 579
Alw21I GWGCWC 1 cut(s) 279
Alw26I GTCTC 1 cut(s) 728
AlwI GGATC 4 cut(s) 10, 523, 536, 644
ApeKI GCWGC 2 cut(s) 173, 493
ApoI RAATTY 2 cut(s) 153, 211
AspS9I GGNCC 1 cut(s) 508
AvaII GGWCC 1 cut(s) 508
BamHI GGATCC 1 cut(s) 528
BauI CACGAG 1 cut(s) 624
BbsI GAAGAC 3 cut(s) 171, 228, 350
Bbv12I GWGCWC 1 cut(s) 279
BbvI GCAGC 2 cut(s) 185, 505
BccI CCATC 2 cut(s) 648, 652
BciT130I CCWGG 1 cut(s) 499
BcoDI GTCTC 1 cut(s) 728
BfaI CTAG 3 cut(s) 135, 702, 707
BfmI CTRYAG 1 cut(s) 598
BfuAI ACCTGC 2 cut(s) 15, 130
BisI GCNGC 2 cut(s) 174, 494
BlsI GCNGC 2 cut(s) 175, 495
Bme1390I CCNGG 1 cut(s) 499
Bme18I GGWCC 1 cut(s) 508
BmgT120I GGNCC 1 cut(s) 508
BmiI GGNNCC 2 cut(s) 530, 550
BmrFI CCNGG 1 cut(s) 499
BmsI GCATC 1 cut(s) 14
BpiI GAAGAC 3 cut(s) 171, 228, 350
BpmI CTGGAG 1 cut(s) 348
BpuEI CTTGAG 1 cut(s) 322
BsaJI CCNNGG 2 cut(s) 497, 498
Bsc4I CCNNNNNNNGG 1 cut(s) 525
Bse1I ACTGG 1 cut(s) 617
BseBI CCWGG 1 cut(s) 499
BseDI CCNNGG 2 cut(s) 497, 498
BseGI GGATG 2 cut(s) 659, 663
BseLI CCNNNNNNNGG 1 cut(s) 525
BseMII CTCAG 1 cut(s) 702
BseNI ACTGG 1 cut(s) 617
BseXI GCAGC 2 cut(s) 185, 505
BsiHKAI GWGCWC 1 cut(s) 279
BslI CCNNNNNNNGG 1 cut(s) 525
BsmAI GTCTC 1 cut(s) 728
Bsp1286I GDGCHC 1 cut(s) 279
Bsp143I GATC 4 cut(s) 15, 243, 528, 636
BspCNI CTCAG 2 cut(s) 701, 732
BspHI TCATGA 1 cut(s) 728
BspLI GGNNCC 2 cut(s) 530, 550
BspMI ACCTGC 2 cut(s) 15, 130
BspPI GGATC 4 cut(s) 10, 523, 536, 644
BsrI ACTGG 1 cut(s) 617
BssECI CCNNGG 2 cut(s) 497, 498
BssMI GATC 4 cut(s) 15, 243, 528, 636
BssSI CACGAG 1 cut(s) 624
Bst2BI CACGAG 1 cut(s) 624
Bst2UI CCWGG 1 cut(s) 499
Bst4CI ACNGT 1 cut(s) 477
Bst6I CTCTTC 4 cut(s) 111, 222, 228, 234
BstC8I GCNNGC 1 cut(s) 132
BstDEI CTNAG 3 cut(s) 663, 688, 719
BstF5I GGATG 2 cut(s) 659, 663
BstKTI GATC 4 cut(s) 18, 246, 531, 639
BstMAI GTCTC 1 cut(s) 728
BstMBI GATC 4 cut(s) 15, 243, 528, 636
BstMWI GCNNNNNNNGC 3 cut(s) 136, 422, 707
BstNI CCWGG 1 cut(s) 499
BstNSI RCATGY 1 cut(s) 91
BstSCI CCNGG 1 cut(s) 497
BstSFI CTRYAG 1 cut(s) 598
BstV1I GCAGC 2 cut(s) 185, 505
BstV2I GAAGAC 3 cut(s) 171, 228, 350
BstX2I RGATCY 2 cut(s) 528, 636
BstXI CCANNNNNNTGG 1 cut(s) 545
BstYI RGATCY 2 cut(s) 528, 636
BtsCI GGATG 2 cut(s) 659, 663
BtsIMutI CAGTG 1 cut(s) 624
BveI ACCTGC 2 cut(s) 15, 130
Cac8I GCNNGC 1 cut(s) 132
CciI TCATGA 1 cut(s) 728
Cfr13I GGNCC 1 cut(s) 508
Csp6I GTAC 2 cut(s) 187, 330
CviAII CATG 8 cut(s) 88, 218, 249, 413, 520, 545, 568, 729
CviJI RGCY 7 cut(s) 134, 176, 299, 496, 549, 579, 662
CviKI_1 RGCY 7 cut(s) 134, 176, 299, 496, 549, 579, 662
CviQI GTAC 2 cut(s) 187, 330
DdeI CTNAG 3 cut(s) 663, 688, 719
DpnI GATC 4 cut(s) 17, 245, 530, 638
DpnII GATC 4 cut(s) 15, 243, 528, 636
Eam1104I CTCTTC 4 cut(s) 111, 222, 228, 234
EarI CTCTTC 4 cut(s) 111, 222, 228, 234
Eco47I GGWCC 1 cut(s) 508
Eco57I CTGAAG 1 cut(s) 183
EcoO109I RGGNCCY 1 cut(s) 508
EcoRII CCWGG 1 cut(s) 497
FaeI CATG 8 cut(s) 91, 221, 252, 416, 523, 548, 571, 732
FatI CATG 8 cut(s) 87, 217, 248, 412, 519, 544, 567, 728
Fnu4HI GCNGC 2 cut(s) 174, 494
FokI GGATG 2 cut(s) 666, 670
Fsp4HI GCNGC 2 cut(s) 174, 494
FspBI CTAG 3 cut(s) 135, 702, 707
GluI GCNGC 2 cut(s) 174, 494
GsuI CTGGAG 1 cut(s) 348
Hin1II CATG 8 cut(s) 91, 221, 252, 416, 523, 548, 571, 732
HincII GTYRAC 2 cut(s) 93, 207
HindII GTYRAC 2 cut(s) 93, 207
HpaI GTTAAC 1 cut(s) 207
Hpy166II GTNNAC 3 cut(s) 93, 189, 207
Hpy188I TCNGA 3 cut(s) 553, 586, 691
Hpy188III TCNNGA 5 cut(s) 61, 365, 386, 626, 729
Hpy8I GTNNAC 3 cut(s) 93, 189, 207
Hpy99I CGWCG 1 cut(s) 264
HpyCH4III ACNGT 1 cut(s) 477
HpyCH4V TGCA 4 cut(s) 27, 130, 339, 470
HpyF10VI GCNNNNNNNGC 3 cut(s) 136, 422, 707
HpyF3I CTNAG 3 cut(s) 663, 688, 719
Hsp92II CATG 8 cut(s) 91, 221, 252, 416, 523, 548, 571, 732
KspAI GTTAAC 1 cut(s) 207
Kzo9I GATC 4 cut(s) 15, 243, 528, 636
LmnI GCTCC 2 cut(s) 274, 554
LpnPI CCDG 8 cut(s) 20, 125, 174, 371, 378, 484, 511, 630
Lsp1109I GCAGC 2 cut(s) 185, 505
LweI GCATC 1 cut(s) 14
MaeI CTAG 3 cut(s) 135, 702, 707
MaeIII GTNAC 1 cut(s) 68
MalI GATC 4 cut(s) 17, 245, 530, 638
MboI GATC 4 cut(s) 15, 243, 528, 636
MboII GAAGA 9 cut(s) 113, 116, 128, 176, 233, 239, 245, 251, 350
MflI RGATCY 2 cut(s) 528, 636
MhlI GDGCHC 1 cut(s) 279
MluCI AATT 3 cut(s) 153, 211, 481
MmeI TCCRAC 1 cut(s) 63
MnlI CCTC 9 cut(s) 112, 223, 229, 297, 372, 521, 525, 633, 697
MseI TTAA 3 cut(s) 144, 206, 504
MspR9I CCNGG 1 cut(s) 499
MvaI CCWGG 1 cut(s) 499
MwoI GCNNNNNNNGC 3 cut(s) 136, 422, 707
NdeII GATC 4 cut(s) 15, 243, 528, 636
NlaIII CATG 8 cut(s) 91, 221, 252, 416, 523, 548, 571, 732
NlaIV GGNNCC 2 cut(s) 530, 550
NspI RCATGY 1 cut(s) 91
PagI TCATGA 1 cut(s) 728
PasI CCCWGGG 1 cut(s) 498
PciI ACATGT 1 cut(s) 87
PflMI CCANNNNNTGG 1 cut(s) 525
PkrI GCNGC 2 cut(s) 175, 495
PpuMI RGGWCCY 1 cut(s) 508
PscI ACATGT 1 cut(s) 87
Psp5II RGGWCCY 1 cut(s) 508
Psp6I CCWGG 1 cut(s) 497
PspGI CCWGG 1 cut(s) 497
PspN4I GGNNCC 2 cut(s) 530, 550
PspPI GGNCC 1 cut(s) 508
PspPPI RGGWCCY 1 cut(s) 508
PsrI GAACNNNNNNTAC 2 cut(s) 13, 45
PsuI RGATCY 2 cut(s) 528, 636
RsaI GTAC 2 cut(s) 188, 331
RsaNI GTAC 2 cut(s) 187, 330
SaqAI TTAA 3 cut(s) 144, 206, 504
SatI GCNGC 2 cut(s) 174, 494
Sau3AI GATC 4 cut(s) 15, 243, 528, 636
Sau96I GGNCC 1 cut(s) 508
ScrFI CCNGG 1 cut(s) 499
SduI GDGCHC 1 cut(s) 279
SetI ASST 5 cut(s) 9, 136, 144, 510, 581
SfaNI GCATC 1 cut(s) 14
SfcI CTRYAG 1 cut(s) 598
SinI GGWCC 1 cut(s) 508
SmlI CTYRAG 1 cut(s) 301
SmoI CTYRAG 1 cut(s) 301
Sse9I AATT 3 cut(s) 153, 211, 481
SspMI CTAG 3 cut(s) 135, 702, 707
StyD4I CCNGG 1 cut(s) 497
TaaI ACNGT 1 cut(s) 477
TasI AATT 3 cut(s) 153, 211, 481
TatI WGTACW 1 cut(s) 186
Tru1I TTAA 3 cut(s) 144, 206, 504
Tru9I TTAA 3 cut(s) 144, 206, 504
TscAI CASTG 1 cut(s) 624
TseI GCWGC 2 cut(s) 173, 493
TspDTI ATGAA 6 cut(s) 17, 46, 114, 123, 234, 623
TspGWI ACGGA 1 cut(s) 8
TspRI CASTG 1 cut(s) 624
Van91I CCANNNNNTGG 1 cut(s) 525
VpaK11BI GGWCC 1 cut(s) 508
XapI RAATTY 2 cut(s) 153, 211
XceI RCATGY 1 cut(s) 91
XspI CTAG 3 cut(s) 135, 702, 707
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.