Rmu_sc0002460.1_g000083

Regulator of Vps4 activity in the MVB pathway

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002460.1
OG0017928
Physical Location & Seq
Reverse (-)
408439 .. 409481
1043 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002460.1_g000083.1.cds

Sequence Viewer

Length: 855 bp
atgtttcagagtgttgcagcaaacttattttacattttcaaatgttgcaatgccttacaagacttgcctagtgatgttggtgaagcgatggcaagtttgatttatgctgcctcaagatgtggtgaactgccagatctaccccgaatacgttgcctattcaaagagagatatggatcagaatttgacagtaccagagctgaactgcggcatgggaatcttgtgaatcctcagttgaaagagaagctaggcataactcggattccagacgaggtgaaacaagagctgataggagatatagttaccaagggcaatatccgtctggccctccaggatgtccaagacacgatacaccagaactatagcttcccagacaaaagtttcaagtatgagcagaaagctgatgggattcaaatacaagttccaaaatcggagatggggaggaaacctgatgggatattttgttctttgtcaaaaggtaaactttcggtggccactgcattcccttcttatattggctcagataatggttcaggtagctcaggccctatgactgatttagccagaaaaggctcaaatgggaaaagagatggttccaagatggtgatgagtcaccattctttcaatacttcagttgatgaagtcaaaatgccaaacggaagctctccttactccagccatgtccaccccaagcttccggaatatgatgatgtgatggccaaacttcgccatctcaaggcagaacatagtaggcctaagacctttgcattttctgacattttcgaggaggatgtagcaatgggatatctcaaatacgttaggtcaaaagtgaagtttaggttggagtcgggtgaatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04144 map04144
Pfam Domains
Protein Families
Ist1

Protein Analysis

284

Amino Acids

31.67

Weight (kDa)

8.46

Isoelectric Point (pI)

36.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017928)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G15490
fragaria_vesca FvH4_3g20621
malus_domestica MD03G1223500.v1.1
prunus_persica Prupe.4G186000_v2.0.a1 Prupe.4G186000_v2.0.a1
rosa_laevigata RLG00000033564
rosa_multiflora Rmu_sc0002460.1_g000083
rosa_roxburghii Rroxscaffold_1G00045670
rosa_samantha Rh5BG240200 Rh5CG270600 Rh5DG248400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 694
AciI CCGC 1 cut(s) 205
AclWI GGATC 1 cut(s) 181
AcoI YGGCCR 2 cut(s) 489, 714
AcsI RAATTY 1 cut(s) 179
AcuI CTGAAG 1 cut(s) 612
AfaI GTAC 1 cut(s) 190
AfiI CCNNNNNNNGG 1 cut(s) 733
AgsI TTSAA 6 cut(s) 40, 160, 235, 382, 410, 622
AjnI CCWGG 1 cut(s) 327
AjuI GAANNNNNNNTTGG 2 cut(s) 821, 853
AloI GAACNNNNNNTCC 2 cut(s) 445, 477
AluBI AGCT 8 cut(s) 197, 244, 283, 363, 398, 537, 660, 691
AluI AGCT 8 cut(s) 197, 244, 283, 363, 398, 537, 660, 691
AlwI GGATC 1 cut(s) 181
Aor13HI TCCGGA 1 cut(s) 694
AoxI GGCC 5 cut(s) 321, 489, 541, 714, 749
ApeKI GCWGC 2 cut(s) 17, 107
ApoI RAATTY 1 cut(s) 179
AspS9I GGNCC 2 cut(s) 322, 542
AsuHPI GGTGA 5 cut(s) 92, 134, 283, 602, 613
BalI TGGCCA 2 cut(s) 491, 716
BbvI GCAGC 2 cut(s) 29, 94
BccI CCATC 8 cut(s) 82, 395, 427, 443, 581, 592, 706, 735
BcgI CGANNNNNNTGC 2 cut(s) 132, 166
BciT130I CCWGG 1 cut(s) 329
BfaI CTAG 2 cut(s) 69, 245
BfmI CTRYAG 1 cut(s) 358
BglII AGATCT 1 cut(s) 133
BisI GCNGC 3 cut(s) 18, 108, 206
BlsI GCNGC 3 cut(s) 19, 109, 207
Bme1390I CCNGG 1 cut(s) 329
BmgT120I GGNCC 2 cut(s) 322, 542
BmiI GGNNCC 1 cut(s) 592
BmrFI CCNGG 1 cut(s) 329
BpmI CTGGAG 2 cut(s) 311, 655
Bpu10I CCTNAGC 1 cut(s) 538
BpuEI CTTGAG 2 cut(s) 97, 716
BsaBI GATNNNNATC 1 cut(s) 172
BsaJI CCNNGG 1 cut(s) 303
BsaWI WCCGGW 1 cut(s) 694
BsaXI ACNNNNNCTCC 2 cut(s) 282, 312
Bsc4I CCNNNNNNNGG 1 cut(s) 733
Bse3DI GCAATG 2 cut(s) 55, 801
Bse8I GATNNNNATC 1 cut(s) 172
BseAI TCCGGA 1 cut(s) 694
BseBI CCWGG 1 cut(s) 329
BseDI CCNNGG 1 cut(s) 303
BseGI GGATG 2 cut(s) 337, 793
BseJI GATNNNNATC 1 cut(s) 172
BseLI CCNNNNNNNGG 1 cut(s) 733
BseMI GCAATG 2 cut(s) 55, 801
BseMII CTCAG 3 cut(s) 242, 531, 552
BseRI GAGGAG 1 cut(s) 797
BseXI GCAGC 2 cut(s) 29, 94
BshFI GGCC 5 cut(s) 323, 491, 543, 716, 751
BsiSI CCGG 1 cut(s) 695
BslI CCNNNNNNNGG 1 cut(s) 733
BsmI GAATGC 1 cut(s) 497
BsnI GGCC 5 cut(s) 323, 491, 543, 716, 751
Bsp13I TCCGGA 1 cut(s) 694
Bsp143I GATC 2 cut(s) 133, 173
BspACI CCGC 1 cut(s) 205
BspANI GGCC 5 cut(s) 323, 491, 543, 716, 751
BspCNI CTCAG 3 cut(s) 241, 530, 551
BspEI TCCGGA 1 cut(s) 694
BspLI GGNNCC 1 cut(s) 592
BspPI GGATC 1 cut(s) 181
BsrDI GCAATG 2 cut(s) 55, 801
BssECI CCNNGG 1 cut(s) 303
BssMI GATC 2 cut(s) 133, 173
BssT1I CCWWGG 1 cut(s) 303
Bst2UI CCWGG 1 cut(s) 329
Bst4CI ACNGT 1 cut(s) 188
BstDEI CTNAG 4 cut(s) 228, 517, 538, 753
BstF5I GGATG 2 cut(s) 337, 793
BstKTI GATC 2 cut(s) 136, 176
BstMBI GATC 2 cut(s) 133, 173
BstNI CCWGG 1 cut(s) 329
BstSCI CCNGG 1 cut(s) 327
BstSFI CTRYAG 1 cut(s) 358
BstV1I GCAGC 2 cut(s) 29, 94
BstX2I RGATCY 1 cut(s) 133
BstYI RGATCY 1 cut(s) 133
BsuRI GGCC 5 cut(s) 323, 491, 543, 716, 751
BtgZI GCGATG 1 cut(s) 101
BtsCI GGATG 2 cut(s) 337, 793
BtsI GCAGTG 1 cut(s) 492
BtsIMutI CAGTG 1 cut(s) 492
Cfr13I GGNCC 2 cut(s) 322, 542
Csp6I GTAC 1 cut(s) 189
CviAII CATG 2 cut(s) 209, 677
CviQI GTAC 1 cut(s) 189
DdeI CTNAG 4 cut(s) 228, 517, 538, 753
DpnI GATC 2 cut(s) 135, 175
DpnII GATC 2 cut(s) 133, 173
EaeI YGGCCR 2 cut(s) 489, 714
Eco130I CCWWGG 1 cut(s) 303
Eco147I AGGCCT 1 cut(s) 751
Eco32I GATATC 1 cut(s) 803
Eco57I CTGAAG 1 cut(s) 612
EcoO109I RGGNCCY 1 cut(s) 542
EcoRII CCWGG 1 cut(s) 327
EcoRV GATATC 1 cut(s) 803
EcoT14I CCWWGG 1 cut(s) 303
ErhI CCWWGG 1 cut(s) 303
FaeI CATG 2 cut(s) 212, 680
FalI AAGNNNNNCTT 4 cut(s) 465, 497, 649, 681
FatI CATG 2 cut(s) 208, 676
Fnu4HI GCNGC 3 cut(s) 18, 108, 206
FokI GGATG 2 cut(s) 344, 800
Fsp4HI GCNGC 3 cut(s) 18, 108, 206
FspBI CTAG 2 cut(s) 69, 245
GluI GCNGC 3 cut(s) 18, 108, 206
GsuI CTGGAG 2 cut(s) 311, 655
HaeIII GGCC 5 cut(s) 323, 491, 543, 716, 751
HapII CCGG 1 cut(s) 695
Hin1II CATG 2 cut(s) 212, 680
HindIII AAGCTT 1 cut(s) 689
HinfI GANTC 6 cut(s) 214, 223, 259, 406, 607, 842
HpaII CCGG 1 cut(s) 695
HphI GGTGA 5 cut(s) 92, 134, 283, 602, 613
Hpy166II GTNNAC 3 cut(s) 125, 479, 682
Hpy188I TCNGA 6 cut(s) 9, 178, 258, 430, 520, 772
Hpy188III TCNNGA 3 cut(s) 114, 263, 695
Hpy8I GTNNAC 3 cut(s) 125, 479, 682
HpyAV CCTTC 1 cut(s) 513
HpyCH4III ACNGT 1 cut(s) 188
HpyCH4IV ACGT 2 cut(s) 148, 813
HpyCH4V TGCA 4 cut(s) 17, 48, 497, 764
HpyF3I CTNAG 4 cut(s) 228, 517, 538, 753
HpySE526I ACGT 2 cut(s) 148, 813
Hsp92II CATG 2 cut(s) 212, 680
Kpn2I TCCGGA 1 cut(s) 694
Kzo9I GATC 2 cut(s) 133, 173
Lsp1109I GCAGC 2 cut(s) 29, 94
MaeI CTAG 2 cut(s) 69, 245
MaeII ACGT 2 cut(s) 148, 813
MaeIII GTNAC 2 cut(s) 298, 608
MalI GATC 2 cut(s) 135, 175
MboI GATC 2 cut(s) 133, 173
MflI RGATCY 1 cut(s) 133
MlsI TGGCCA 2 cut(s) 491, 716
MluCI AATT 1 cut(s) 179
MluNI TGGCCA 2 cut(s) 491, 716
MlyI GAGTC 2 cut(s) 616, 851
MmeI TCCRAC 1 cut(s) 819
MnlI CCTC 7 cut(s) 121, 237, 262, 335, 432, 775, 778
Mox20I TGGCCA 2 cut(s) 491, 716
MroI TCCGGA 1 cut(s) 694
MscI TGGCCA 2 cut(s) 491, 716
Msp20I TGGCCA 2 cut(s) 491, 716
MspI CCGG 1 cut(s) 695
MspR9I CCNGG 1 cut(s) 329
Mva1269I GAATGC 1 cut(s) 497
MvaI CCWGG 1 cut(s) 329
NdeII GATC 2 cut(s) 133, 173
NlaIII CATG 2 cut(s) 212, 680
NlaIV GGNNCC 1 cut(s) 592
NmuCI GTSAC 1 cut(s) 608
PceI AGGCCT 1 cut(s) 751
PctI GAATGC 1 cut(s) 497
PfeI GAWTC 4 cut(s) 214, 223, 259, 406
PfoI TCCNGGA 1 cut(s) 327
PkrI GCNGC 3 cut(s) 19, 109, 207
PleI GAGTC 2 cut(s) 615, 850
PpsI GAGTC 2 cut(s) 615, 850
Psp6I CCWGG 1 cut(s) 327
PspGI CCWGG 1 cut(s) 327
PspN4I GGNNCC 1 cut(s) 592
PspPI GGNCC 2 cut(s) 322, 542
PsuI RGATCY 1 cut(s) 133
RsaI GTAC 1 cut(s) 190
RsaNI GTAC 1 cut(s) 189
SatI GCNGC 3 cut(s) 18, 108, 206
Sau3AI GATC 2 cut(s) 133, 173
Sau96I GGNCC 2 cut(s) 322, 542
SchI GAGTC 2 cut(s) 616, 851
ScrFI CCNGG 1 cut(s) 329
SfcI CTRYAG 1 cut(s) 358
SmlI CTYRAG 2 cut(s) 112, 731
SmoI CTYRAG 2 cut(s) 112, 731
Sse9I AATT 1 cut(s) 179
SseBI AGGCCT 1 cut(s) 751
SsiI CCGC 1 cut(s) 205
SspMI CTAG 2 cut(s) 69, 245
StuI AGGCCT 1 cut(s) 751
StyD4I CCNGG 1 cut(s) 327
StyI CCWWGG 1 cut(s) 303
TaaI ACNGT 1 cut(s) 188
TaiI ACGT 2 cut(s) 151, 816
TaqI TCGA 1 cut(s) 780
TasI AATT 1 cut(s) 179
TauI GCSGC 1 cut(s) 208
TfiI GAWTC 4 cut(s) 214, 223, 259, 406
TscAI CASTG 1 cut(s) 499
TseFI GTSAC 1 cut(s) 608
TseI GCWGC 2 cut(s) 17, 107
Tsp45I GTSAC 1 cut(s) 608
TspDTI ATGAA 1 cut(s) 651
TspGWI ACGGA 2 cut(s) 305, 669
TspRI CASTG 1 cut(s) 499
XapI RAATTY 1 cut(s) 179
XspI CTAG 2 cut(s) 69, 245
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.