Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002538.1

Orthogroup ID

OG0015791

Physical Location & Seq

Genomic Coordinates Forward (+)

28581 .. 31914

Gene Structure 3334 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002538.1_g000007.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 2043 bp

atggaaacccagctctcaatgttggttattctgctcgcttcttttctaactgcaactacttttgtttcctgctcccaacttcaagaccctgatctagtagtacaggaggtccacaggaatatcaatgcgtctaggaggcagctggcctattcctcatgtggaagtggcaaccccatagacgactgctggcggtgcgaccctaactgggaacaaaaccgccagcgcttggccgattgcgccatcggcttcggcaaggacgcaattggcgggagaaacggccgaatctacgtagtctccgactcaggcgacgatgaccctgtgaaccctaggcccggaaccatccgacacgccgtgatacaagacgagccactgtggatcattttcaagagggacatggtgatccagctgaagcaagagctggtcatgaactcgttcaagaccatagacggtagaggtgcgagtgttcacattgccaatggaccatgcatcaccatacatcatgtcaccaacatcatcatccatgggatcaacatacacgactgtaagcaggccgggaacggagacattagggactccccgagccacgccgggtggtggacgcagtccgacggggacggcgtgtcgattttcggcggaaagcacatttgggttgaccattgctcgctgtcaaattgtcacgatggactcatcgatgccatacatggatcgacggccatcacgatttcgaacaacttcatgacgcatcatgacaaggttatgcttttagggcacagtgattcgtttacggaagacaagggcatgcaggtcactgttgcgtttaatcactttggagaagggctcgtgcaaagaatgccaaggtgtagacatggatattttcatgtggtgaacaatgactatacacattgggagatgtatgcaataggagggagtgcttccccaaccatcttaagtcaaggcaatagatttcttgcaccggatagaagtttcgataaagaggtgacaaaacatgaggatgcgccggaaagtgagtggaagaagtggaactggagatccgagggggatttgatgctgaacggcgcatttttccggcaatcgggtgccgcagtagatttcggagcctcaccgggaggaacaacaggggaatcactaccggtagtggtgtcatcggtggggacggggggagatgatgcagccgatgagtctggtaccggtgcggaggaggttgaagaggagtcgtcggagctggatgatgatgaccccttgggtggcttgctgctgctgcctgaagatgaagatgaagatgatgagtcagatgaatcagatgatgaagatcctgagcccttgggtgacggtgctttgccgccgctaccgccagaggtagttggtgctttagcgctgccgctactgctaccgccagaggaagatcctgaccccttgggtggtgatgctttgcctccaccgctgccgcctccactgctaccgccagaggacgagtcggacgagtcggatgaaggtcccggagacgctttaggtgaaggagactgtttgggggatggtgctgatttgccgcttgagccgccggaagaagaagagtccggtgcgttggcgggagatgacttaggagatggtgaagaagtgggagaggatgaggagccccccttgtcggacttgggtgacggtgccgatgaagacgagtccgagcccttcggggatgatgctgatgaggatgagtctttcgccttgggggcatcggccgatgatgatgaggaggacgagtctttcgccttgggggcatcggccgatgatgatgaggaggacgagtctttcgggttagggggtgatgctgatggagaaccgtcgtcgccgtcgctttccgtgtcttttttcggattctttgaggccttggagggtgctggtgactccgccatggcaactccgataatggcaaccaacatgagagcgagaatgatcactttcctactcgccattttgaccattgtcgtagtagtagtgctgagcttgaggtcagtgttcttcttctag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005576 GO:0008150 GO:0009605 GO:0009607 GO:0009624 GO:0043207 GO:0050896 GO:0051704 GO:0051707

KEGG Pathways

Metabolic & Signaling

ko00040 ko02024 map00040 map02024

Pfam Domains

Protein Families

Pec_lyase_C

Protein Analysis

680

Amino Acids

72.89

Weight (kDa)

4.05

Isoelectric Point (pI)

49.75

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015791)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G27400 AT3G27400
fragaria_vesca	FvH4_6g52190
malus_domestica	MD09G1019900.v1.1
prunus_persica	Prupe.3G296600_v2.0.a1
pyrus_communis	pycom111g01650
rosa_chinensis	RchiOBHm_Chr2g0173681
rosa_laevigata	RLG00000022214
rosa_multiflora	Rmu_sc0002538.1_g000007
rosa_rugosa	Rorug02G0572300
rosa_samantha	Rh2AG651200 Rh2BG661600 Rh2CG626600 Rh2DG676900
rosa_wichuraiana	Rw2G053440

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	793
Acc65I	GGTACC	1 cut(s)	1205
AccB1I	GGYRCC	3 cut(s)	1097, 1205, 1679
AccB7I	CCANNNNNTGG	1 cut(s)	226
AccI	GTMKAC	1 cut(s)	862
AclWI	GGATC	7 cut(s)	383, 394, 533, 712, 1044, 1325, 1418
AcoI	YGGCCR	5 cut(s)	228, 277, 711, 1752, 1797
AcuI	CTGAAG	2 cut(s)	428, 1305
AdeI	CACNNNGTG	1 cut(s)	352
AfaI	GTAC	2 cut(s)	102, 1207
AfeI	AGCGCT	2 cut(s)	224, 1395
AfiI	CCNNNNNNNGG	8 cut(s)	205, 226, 332, 594, 1093, 1265, 1439, 1663
AflII	CTTAAG	1 cut(s)	946
AgeI	ACCGGT	2 cut(s)	1150, 1208
AgsI	TTSAA	4 cut(s)	83, 385, 436, 1226
AhdI	GACNNNNNGTC	1 cut(s)	619
AjuI	GAANNNNNNNTTGG	2 cut(s)	628, 660
AloI	GAACNNNNNNTCC	2 cut(s)	1034, 1066
AluBI	AGCT	6 cut(s)	13, 142, 406, 418, 1243, 2019
AluI	AGCT	6 cut(s)	13, 142, 406, 418, 1243, 2019
Alw26I	GTCTC	4 cut(s)	298, 555, 1515, 1533
AlwI	GGATC	7 cut(s)	383, 394, 533, 712, 1044, 1325, 1418
Ama87I	CYCGRG	1 cut(s)	577
Aor51HI	AGCGCT	2 cut(s)	224, 1395
AoxI	GGCC	9 cut(s)	144, 228, 277, 329, 549, 711, 1752, 1797, 1899
ApeKI	GCWGC	7 cut(s)	139, 1190, 1273, 1276, 1279, 1396, 1462
ArsI	GACNNNNNNTTYG	4 cut(s)	1763, 1795, 1808, 1840
AsiGI	ACCGGT	2 cut(s)	1150, 1208
Asp700I	GAANNNNTTC	2 cut(s)	431, 731
Asp718I	GGTACC	1 cut(s)	1205
AspA2I	CCTAGG	1 cut(s)	326
AspLEI	GCGC	5 cut(s)	225, 239, 1018, 1079, 1396
AspS9I	GGNCC	4 cut(s)	109, 330, 479, 1514
AsuC2I	CCSGG	5 cut(s)	333, 553, 589, 1125, 1518
AsuII	TTCGAA	1 cut(s)	725
AvaI	CYCGRG	1 cut(s)	577
AvaII	GGWCC	3 cut(s)	109, 479, 1514
AvrII	CCTAGG	1 cut(s)	326
BaeGI	GKGCMC	1 cut(s)	771
BanI	GGYRCC	3 cut(s)	1097, 1205, 1679
BanII	GRGCYC	4 cut(s)	840, 1341, 1656, 1704
BauI	CACGAG	1 cut(s)	839
BbsI	GAAGAC	2 cut(s)	795, 1695
BbvI	GCAGC	7 cut(s)	151, 1202, 1260, 1263, 1266, 1383, 1449
BccI	CCATC	8 cut(s)	248, 347, 674, 722, 950, 1547, 1619, 1841
BceAI	ACGGC	6 cut(s)	292, 335, 631, 726, 1090, 1849
BclI	TGATCA	1 cut(s)	1968
BcnI	CCSGG	5 cut(s)	333, 553, 589, 1125, 1518
BcoDI	GTCTC	4 cut(s)	298, 555, 1515, 1533
BfaI	CTAG	4 cut(s)	95, 132, 327, 2041
BfoI	RGCGCY	2 cut(s)	226, 1397
BfrI	CTTAAG	1 cut(s)	946
BfuAI	ACCTGC	1 cut(s)	793
BglI	GCCNNNNNGGC	2 cut(s)	1745, 1790
BlnI	CCTAGG	1 cut(s)	326
BlpI	GCTNAGC	1 cut(s)	2015
Bme1390I	CCNGG	5 cut(s)	333, 553, 589, 1125, 1518
Bme18I	GGWCC	3 cut(s)	109, 479, 1514
BmeRI	GACNNNNNGTC	1 cut(s)	619
BmeT110I	CYCGRG	1 cut(s)	577
BmgT120I	GGNCC	4 cut(s)	109, 330, 479, 1514
BmiI	GGNNCC	7 cut(s)	337, 1099, 1117, 1207, 1516, 1653, 1681
BmrFI	CCNGG	5 cut(s)	333, 553, 589, 1125, 1518
BmrI	ACTGGG	1 cut(s)	214
BmuI	ACTGGG	1 cut(s)	214
BoxI	GACNNNNGTC	1 cut(s)	1997
BpiI	GAAGAC	2 cut(s)	795, 1695
BplI	GAGNNNNNCTC	2 cut(s)	822, 854
BpmI	CTGGAG	1 cut(s)	1066
Bpu10I	CCTNAGC	1 cut(s)	1335
Bpu1102I	GCTNAGC	1 cut(s)	2015
Bpu14I	TTCGAA	1 cut(s)	725
BpuEI	CTTGAG	2 cut(s)	1592, 2041
BpuMI	CCSGG	5 cut(s)	333, 553, 589, 1125, 1518
Bsa29I	ATCGAT	1 cut(s)	690
BsaAI	YACGTR	1 cut(s)	289
BsaBI	GATNNNNATC	1 cut(s)	1329
BsaWI	WCCGGW	4 cut(s)	973, 1150, 1208, 1595
BsaXI	ACNNNNNCTCC	6 cut(s)	278, 308, 1760, 1790, 1805, 1835
Bsc4I	CCNNNNNNNGG	8 cut(s)	205, 226, 332, 594, 1093, 1265, 1439, 1663
Bse118I	RCCGGY	2 cut(s)	1150, 1208
Bse1I	ACTGG	2 cut(s)	209, 1049
Bse3DI	GCAATG	2 cut(s)	468, 655
Bse8I	GATNNNNATC	1 cut(s)	1329
BseCI	ATCGAT	1 cut(s)	690
BseGI	GGATG	9 cut(s)	339, 516, 1018, 1252, 1513, 1558, 1651, 1717, 1732
BseJI	GATNNNNATC	1 cut(s)	1329
BseLI	CCNNNNNNNGG	8 cut(s)	205, 226, 332, 594, 1093, 1265, 1439, 1663
BseMI	GCAATG	2 cut(s)	468, 655
BseMII	CTCAG	3 cut(s)	315, 1326, 2006
BseNI	ACTGG	2 cut(s)	209, 1049
BseRI	GAGGAG	5 cut(s)	1232, 1244, 1664, 1781, 1826
BseSI	GKGCMC	1 cut(s)	771
BseX3I	CGGCCG	3 cut(s)	277, 1752, 1797
BseXI	GCAGC	7 cut(s)	151, 1202, 1260, 1263, 1266, 1383, 1449
BseYI	CCCAGC	1 cut(s)	9
Bsh1285I	CGRYCG	3 cut(s)	280, 1755, 1800
BshFI	GGCC	9 cut(s)	146, 230, 279, 331, 551, 713, 1754, 1799, 1901
BshNI	GGYRCC	3 cut(s)	1097, 1205, 1679
BshTI	ACCGGT	2 cut(s)	1150, 1208
BshVI	ATCGAT	1 cut(s)	690
BsiEI	CGRYCG	3 cut(s)	280, 1755, 1800
BsiHKCI	CYCGRG	1 cut(s)	577
BslFI	GGGAC	5 cut(s)	404, 584, 626, 1186, 1500
BslI	CCNNNNNNNGG	8 cut(s)	205, 226, 332, 594, 1093, 1265, 1439, 1663
BsmAI	GTCTC	4 cut(s)	298, 555, 1515, 1533
BsmBI	CGTCTC	1 cut(s)	1515
BsmFI	GGGAC	5 cut(s)	404, 584, 626, 1186, 1500
BsmI	GAATGC	1 cut(s)	855
BsnI	GGCC	9 cut(s)	146, 230, 279, 331, 551, 713, 1754, 1799, 1901
BsoBI	CYCGRG	1 cut(s)	577
Bsp119I	TTCGAA	1 cut(s)	725
Bsp1286I	GDGCHC	5 cut(s)	771, 840, 1341, 1656, 1704
Bsp143I	GATC	9 cut(s)	91, 375, 399, 525, 704, 1049, 1330, 1423, 1968
Bsp1720I	GCTNAGC	1 cut(s)	2015
Bsp19I	CCATGG	2 cut(s)	520, 1926
BspANI	GGCC	9 cut(s)	146, 230, 279, 331, 551, 713, 1754, 1799, 1901
BspCNI	CTCAG	3 cut(s)	314, 1327, 2007
BspDI	ATCGAT	1 cut(s)	690
BspHI	TCATGA	3 cut(s)	423, 735, 745
BspLI	GGNNCC	7 cut(s)	337, 1099, 1117, 1207, 1516, 1653, 1681
BspMI	ACCTGC	1 cut(s)	793
BspPI	GGATC	7 cut(s)	383, 394, 533, 712, 1044, 1325, 1418
BspT104I	TTCGAA	1 cut(s)	725
BspT107I	GGYRCC	3 cut(s)	1097, 1205, 1679
BspTI	CTTAAG	1 cut(s)	946
BsrDI	GCAATG	2 cut(s)	468, 655
BsrFI	RCCGGY	2 cut(s)	1150, 1208
BsrI	ACTGG	2 cut(s)	209, 1049
BssAI	RCCGGY	2 cut(s)	1150, 1208
BssMI	GATC	9 cut(s)	91, 375, 399, 525, 704, 1049, 1330, 1423, 1968
BssSI	CACGAG	1 cut(s)	839
Bst2BI	CACGAG	1 cut(s)	839
Bst4CI	ACNGT	9 cut(s)	372, 449, 542, 773, 811, 1352, 1544, 1679, 1857
Bst6I	CTCTTC	2 cut(s)	1221, 1584
BstAFI	CTTAAG	1 cut(s)	946
BstAPI	GCANNNNNTGC	1 cut(s)	850
BstBAI	YACGTR	1 cut(s)	289
BstBI	TTCGAA	1 cut(s)	725
BstC8I	GCNNGC	8 cut(s)	36, 144, 188, 221, 549, 662, 800, 1271
BstDEI	CTNAG	4 cut(s)	301, 1335, 1618, 2015
BstDSI	CCRYGG	2 cut(s)	520, 1926
BstF5I	GGATG	9 cut(s)	339, 516, 1018, 1252, 1513, 1558, 1651, 1717, 1732
BstH2I	RGCGCY	2 cut(s)	226, 1397
BstHHI	GCGC	5 cut(s)	225, 239, 1018, 1079, 1396
BstKTI	GATC	9 cut(s)	94, 378, 402, 528, 707, 1052, 1333, 1426, 1971
BstMAI	GTCTC	4 cut(s)	298, 555, 1515, 1533
BstMBI	GATC	9 cut(s)	91, 375, 399, 525, 704, 1049, 1330, 1423, 1968
BstMCI	CGRYCG	3 cut(s)	280, 1755, 1800
BstNSI	RCATGY	1 cut(s)	802
BstPAI	GACNNNNGTC	1 cut(s)	1997
BstSCI	CCNGG	5 cut(s)	331, 551, 587, 1123, 1516
BstSLI	GKGCMC	1 cut(s)	771
BstSNI	TACGTA	1 cut(s)	289
BstV1I	GCAGC	7 cut(s)	151, 1202, 1260, 1263, 1266, 1383, 1449
BstV2I	GAAGAC	2 cut(s)	795, 1695
BstX2I	RGATCY	3 cut(s)	1049, 1330, 1423
BstYI	RGATCY	3 cut(s)	1049, 1330, 1423
BstZI	CGGCCG	3 cut(s)	277, 1752, 1797
Bsu15I	ATCGAT	1 cut(s)	690
BsuRI	GGCC	9 cut(s)	146, 230, 279, 331, 551, 713, 1754, 1799, 1901
BsuTUI	ATCGAT	1 cut(s)	690
BtgI	CCRYGG	2 cut(s)	520, 1926
BtsCI	GGATG	9 cut(s)	339, 516, 1018, 1252, 1513, 1558, 1651, 1717, 1732
BtsI	GCAGTG	1 cut(s)	1472
BtsIMutI	CAGTG	5 cut(s)	368, 778, 807, 1472, 2034
BveI	ACCTGC	1 cut(s)	793
Cac8I	GCNNGC	8 cut(s)	36, 144, 188, 221, 549, 662, 800, 1271
CciI	TCATGA	3 cut(s)	423, 735, 745
CfoI	GCGC	5 cut(s)	225, 239, 1018, 1079, 1396
Cfr10I	RCCGGY	2 cut(s)	1150, 1208
Cfr13I	GGNCC	4 cut(s)	109, 330, 479, 1514
ClaI	ATCGAT	1 cut(s)	690
CseI	GACGC	5 cut(s)	117, 266, 607, 748, 1532
Csp6I	GTAC	2 cut(s)	101, 1206
CspAI	ACCGGT	2 cut(s)	1150, 1208
CviQI	GTAC	2 cut(s)	101, 1206
DdeI	CTNAG	4 cut(s)	301, 1335, 1618, 2015
DpnI	GATC	9 cut(s)	93, 377, 401, 527, 706, 1051, 1332, 1425, 1970
DpnII	GATC	9 cut(s)	91, 375, 399, 525, 704, 1049, 1330, 1423, 1968
DraIII	CACNNNGTG	1 cut(s)	352
DriI	GACNNNNNGTC	1 cut(s)	619
EaeI	YGGCCR	5 cut(s)	228, 277, 711, 1752, 1797
EagI	CGGCCG	3 cut(s)	277, 1752, 1797
Eam1104I	CTCTTC	2 cut(s)	1221, 1584
Eam1105I	GACNNNNNGTC	1 cut(s)	619
EarI	CTCTTC	2 cut(s)	1221, 1584
EciI	GGCGGA	2 cut(s)	648, 1912
EclXI	CGGCCG	3 cut(s)	277, 1752, 1797
Eco105I	TACGTA	1 cut(s)	289
Eco147I	AGGCCT	1 cut(s)	1901
Eco24I	GRGCYC	4 cut(s)	840, 1341, 1656, 1704
Eco47I	GGWCC	3 cut(s)	109, 479, 1514
Eco47III	AGCGCT	2 cut(s)	224, 1395
Eco52I	CGGCCG	3 cut(s)	277, 1752, 1797
Eco57I	CTGAAG	2 cut(s)	428, 1305
Eco88I	CYCGRG	1 cut(s)	577
EcoO109I	RGGNCCY	1 cut(s)	1514
EcoT22I	ATGCAT	1 cut(s)	488
EcoT38I	GRGCYC	4 cut(s)	840, 1341, 1656, 1704
Esp3I	CGTCTC	1 cut(s)	1515
FaqI	GGGAC	5 cut(s)	404, 584, 626, 1186, 1500
FauI	CCCGC	2 cut(s)	260, 1600
FbaI	TGATCA	1 cut(s)	1968
FblI	GTMKAC	1 cut(s)	862
FokI	GGATG	9 cut(s)	326, 503, 1025, 1259, 1520, 1565, 1658, 1724, 1739
FriOI	GRGCYC	4 cut(s)	840, 1341, 1656, 1704
FspBI	CTAG	4 cut(s)	95, 132, 327, 2041
GlaI	GCGC	5 cut(s)	224, 238, 1017, 1078, 1395
GsaI	CCCAGC	1 cut(s)	13
GsuI	CTGGAG	1 cut(s)	1066
HaeII	RGCGCY	2 cut(s)	226, 1397
HaeIII	GGCC	9 cut(s)	146, 230, 279, 331, 551, 713, 1754, 1799, 1901
HgaI	GACGC	5 cut(s)	117, 266, 607, 748, 1532
HhaI	GCGC	5 cut(s)	225, 239, 1018, 1079, 1396
Hin6I	GCGC	5 cut(s)	223, 237, 1016, 1077, 1394
HinP1I	GCGC	5 cut(s)	223, 237, 1016, 1077, 1394
HincII	GTYRAC	1 cut(s)	652
HindII	GTYRAC	1 cut(s)	652
Hpy166II	GTNNAC	8 cut(s)	112, 322, 466, 597, 652, 783, 863, 886
Hpy8I	GTNNAC	8 cut(s)	112, 322, 466, 597, 652, 783, 863, 886
Hpy99I	CGWCG	7 cut(s)	311, 611, 712, 1240, 1861, 1864, 1870
HpyAV	CCTTC	4 cut(s)	827, 1505, 1529, 1714
HpyCH4III	ACNGT	9 cut(s)	372, 449, 542, 773, 811, 1352, 1544, 1679, 1857
HpyCH4IV	ACGT	1 cut(s)	288
HpyCH4V	TGCA	7 cut(s)	53, 486, 802, 844, 917, 971, 1190
HpyF3I	CTNAG	4 cut(s)	301, 1335, 1618, 2015
HpySE526I	ACGT	1 cut(s)	288
HspAI	GCGC	5 cut(s)	223, 237, 1016, 1077, 1394
KpnI	GGTACC	1 cut(s)	1209
Ksp22I	TGATCA	1 cut(s)	1968
Kzo9I	GATC	9 cut(s)	91, 375, 399, 525, 704, 1049, 1330, 1423, 1968
LmnI	GCTCC	4 cut(s)	77, 1115, 1240, 1651
Lsp1109I	GCAGC	7 cut(s)	151, 1202, 1260, 1263, 1266, 1383, 1449
MaeI	CTAG	4 cut(s)	95, 132, 327, 2041
MaeII	ACGT	1 cut(s)	288
MaeIII	GTNAC	7 cut(s)	502, 674, 805, 997, 1346, 1673, 1916
MalI	GATC	9 cut(s)	93, 377, 401, 527, 706, 1051, 1332, 1425, 1970
MboI	GATC	9 cut(s)	91, 375, 399, 525, 704, 1049, 1330, 1423, 1968
MfeI	CAATTG	1 cut(s)	261
MflI	RGATCY	3 cut(s)	1049, 1330, 1423
MhlI	GDGCHC	5 cut(s)	771, 840, 1341, 1656, 1704
MluCI	AATT	2 cut(s)	261, 670
MmeI	TCCRAC	7 cut(s)	321, 367, 630, 1218, 1476, 1485, 1644
Mph1103I	ATGCAT	1 cut(s)	488
MroXI	GAANNNNTTC	2 cut(s)	431, 731
MseI	TTAA	2 cut(s)	819, 947
MslI	CAYNNNNRTG	1 cut(s)	1011
MspA1I	CMGCKG	3 cut(s)	142, 406, 1462
MspCI	CTTAAG	1 cut(s)	946
MspR9I	CCNGG	5 cut(s)	333, 553, 589, 1125, 1518
MunI	CAATTG	1 cut(s)	261
Mva1269I	GAATGC	1 cut(s)	855
NciI	CCSGG	5 cut(s)	333, 553, 589, 1125, 1518
NcoI	CCATGG	2 cut(s)	520, 1926
NdeII	GATC	9 cut(s)	91, 375, 399, 525, 704, 1049, 1330, 1423, 1968
NlaIV	GGNNCC	7 cut(s)	337, 1099, 1117, 1207, 1516, 1653, 1681
NmuCI	GTSAC	7 cut(s)	502, 674, 805, 997, 1346, 1673, 1916
NsiI	ATGCAT	1 cut(s)	488
NspI	RCATGY	1 cut(s)	802
NspV	TTCGAA	1 cut(s)	725
PaeI	GCATGC	1 cut(s)	802
PagI	TCATGA	3 cut(s)	423, 735, 745
PceI	AGGCCT	1 cut(s)	1901
PcsI	WCGNNNNNNNCGW	4 cut(s)	294, 615, 716, 1497
PctI	GAATGC	1 cut(s)	855
PdmI	GAANNNNTTC	2 cut(s)	431, 731
PfeI	GAWTC	5 cut(s)	282, 776, 1142, 1316, 1890
PflFI	GACNNNGTC	1 cut(s)	601
PflMI	CCANNNNNTGG	1 cut(s)	226
PfoI	TCCNGGA	1 cut(s)	1516
PinAI	ACCGGT	2 cut(s)	1150, 1208
Ppu21I	YACGTR	1 cut(s)	289
PpuMI	RGGWCCY	1 cut(s)	1514
PshAI	GACNNNNGTC	1 cut(s)	1997
Psp5II	RGGWCCY	1 cut(s)	1514
PspFI	CCCAGC	1 cut(s)	9
PspN4I	GGNNCC	7 cut(s)	337, 1099, 1117, 1207, 1516, 1653, 1681
PspPI	GGNCC	4 cut(s)	109, 330, 479, 1514
PspPPI	RGGWCCY	1 cut(s)	1514
PsuI	RGATCY	3 cut(s)	1049, 1330, 1423
PsyI	GACNNNGTC	1 cut(s)	601
PvuII	CAGCTG	2 cut(s)	142, 406
RsaI	GTAC	2 cut(s)	102, 1207
RsaNI	GTAC	2 cut(s)	101, 1206
RseI	CAYNNNNRTG	1 cut(s)	1011
SaqAI	TTAA	2 cut(s)	819, 947
Sau3AI	GATC	9 cut(s)	91, 375, 399, 525, 704, 1049, 1330, 1423, 1968
Sau96I	GGNCC	4 cut(s)	109, 330, 479, 1514
ScrFI	CCNGG	5 cut(s)	333, 553, 589, 1125, 1518
SduI	GDGCHC	5 cut(s)	771, 840, 1341, 1656, 1704
SfuI	TTCGAA	1 cut(s)	725
SinI	GGWCC	3 cut(s)	109, 479, 1514
SmiMI	CAYNNNNRTG	1 cut(s)	1011
SmlI	CTYRAG	3 cut(s)	946, 1571, 2020
SmoI	CTYRAG	3 cut(s)	946, 1571, 2020
SnaBI	TACGTA	1 cut(s)	289
SphI	GCATGC	1 cut(s)	802
Sse9I	AATT	2 cut(s)	261, 670
SseBI	AGGCCT	1 cut(s)	1901
SspMI	CTAG	4 cut(s)	95, 132, 327, 2041
StuI	AGGCCT	1 cut(s)	1901
StyD4I	CCNGG	5 cut(s)	331, 551, 587, 1123, 1516
TaaI	ACNGT	9 cut(s)	372, 449, 542, 773, 811, 1352, 1544, 1679, 1857
TaiI	ACGT	1 cut(s)	291
TaqI	TCGA	5 cut(s)	623, 690, 707, 725, 987
TasI	AATT	2 cut(s)	261, 670
TatI	WGTACW	1 cut(s)	100
TauI	GCSGC	7 cut(s)	1103, 1363, 1366, 1402, 1468, 1570, 1579
TfiI	GAWTC	5 cut(s)	282, 776, 1142, 1316, 1890
Tru1I	TTAA	2 cut(s)	819, 947
Tru9I	TTAA	2 cut(s)	819, 947
TscAI	CASTG	5 cut(s)	375, 778, 814, 1479, 2034
TseFI	GTSAC	7 cut(s)	502, 674, 805, 997, 1346, 1673, 1916
TseI	GCWGC	7 cut(s)	139, 1190, 1273, 1276, 1279, 1396, 1462
Tsp45I	GTSAC	7 cut(s)	502, 674, 805, 997, 1346, 1673, 1916
TspDTI	ATGAA	9 cut(s)	440, 724, 866, 1305, 1311, 1329, 1341, 1524, 1701
TspGWI	ACGGA	3 cut(s)	573, 800, 1864
TspRI	CASTG	5 cut(s)	375, 778, 814, 1479, 2034
Tth111I	GACNNNGTC	1 cut(s)	601
Van91I	CCANNNNNTGG	1 cut(s)	226
Vha464I	CTTAAG	1 cut(s)	946
VpaK11BI	GGWCC	3 cut(s)	109, 479, 1514
XceI	RCATGY	1 cut(s)	802
XmaJI	CCTAGG	1 cut(s)	326
XmiI	GTMKAC	1 cut(s)	862
XmnI	GAANNNNTTC	2 cut(s)	431, 731
XspI	CTAG	4 cut(s)	95, 132, 327, 2041
Zsp2I	ATGCAT	1 cut(s)	488

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.