Rorug02G0572300

Pectate lyase

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Reverse (-)
69818729 .. 69818884
156 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0572300.1

Sequence Viewer

Length: 156 bp
ATGGGTCATTCTCTATTGAATGAGCAAACTTGGGAGAATAGGCTTCCGTATAATTTTATAAATGCTTTTATATTTGACCAACTAGGGTCAGGTTACCCCAGGAACTATTGGGAAAATTCTGTAATACATACCCGTATGTCATACACACATTTATAA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

51

Amino Acids

6.16

Weight (kDa)

6.23

Isoelectric Point (pI)

21.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015791)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G27400 AT3G27400
fragaria_vesca FvH4_6g52190
malus_domestica MD09G1019900.v1.1
prunus_persica Prupe.3G296600_v2.0.a1
pyrus_communis pycom111g01650
rosa_chinensis RchiOBHm_Chr2g0173681
rosa_laevigata RLG00000022214
rosa_multiflora Rmu_sc0002538.1_g000007
rosa_rugosa Rorug02G0572300
rosa_samantha Rh2AG651200 Rh2BG661600 Rh2CG626600 Rh2DG676900
rosa_wichuraiana Rw2G053440

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 59, 154
AcsI RAATTY 1 cut(s) 115
AgsI TTSAA 1 cut(s) 19
AjnI CCWGG 1 cut(s) 98
ApoI RAATTY 1 cut(s) 115
BciT130I CCWGG 1 cut(s) 100
BfaI CTAG 1 cut(s) 83
Bme1390I CCNGG 1 cut(s) 100
BmrFI CCNGG 1 cut(s) 100
BsaJI CCNNGG 1 cut(s) 98
BseBI CCWGG 1 cut(s) 100
BseDI CCNNGG 1 cut(s) 98
BssECI CCNNGG 1 cut(s) 98
Bst2UI CCWGG 1 cut(s) 100
BstEII GGTNACC 1 cut(s) 92
BstNI CCWGG 1 cut(s) 100
BstPI GGTNACC 1 cut(s) 92
BstSCI CCNGG 1 cut(s) 98
CviJI RGCY 1 cut(s) 43
CviKI_1 RGCY 1 cut(s) 43
Eco91I GGTNACC 1 cut(s) 92
EcoO65I GGTNACC 1 cut(s) 92
EcoRII CCWGG 1 cut(s) 98
FaiI YATR 7 cut(s) 51, 59, 71, 129, 137, 142, 154
FspBI CTAG 1 cut(s) 83
LpnPI CCDG 3 cut(s) 75, 85, 112
MaeI CTAG 1 cut(s) 83
MaeIII GTNAC 1 cut(s) 92
MluCI AATT 2 cut(s) 52, 115
MspR9I CCNGG 1 cut(s) 100
MvaI CCWGG 1 cut(s) 100
PsiI TTATAA 2 cut(s) 59, 154
Psp6I CCWGG 1 cut(s) 98
PspEI GGTNACC 1 cut(s) 92
PspGI CCWGG 1 cut(s) 98
ScrFI CCNGG 1 cut(s) 100
SetI ASST 1 cut(s) 94
SgeI CNNG 6 cut(s) 42, 95, 102, 111, 112, 144
Sse9I AATT 2 cut(s) 52, 115
SspMI CTAG 1 cut(s) 83
StyD4I CCNGG 1 cut(s) 98
TasI AATT 2 cut(s) 52, 115
TspGWI ACGGA 1 cut(s) 36
XapI RAATTY 1 cut(s) 115
XspI CTAG 1 cut(s) 83
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.