Rmu_sc0002549.1_g000024

calcium-binding protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002549.1
Physical Location & Seq
Forward (+)
100848 .. 101378
531 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002549.1_g000024.1.cds

Sequence Viewer

Length: 531 bp
atggaggacatactagcagccacagctcaaccgggctccctctattttctaggactgttcctacccttgttgaagctctggaccaaaaccaaaaattacctaaactattctgagcctcaagtactactaccaacccctgatcagcccctgcaatgcaacaaaggacaagacgaaacgttgctaggcaaagaagaagtgaagatggtgatgggaaggctcggactatgctacgaagatgagggagatgatgttattactaatgaagacatggttggggcagagttgctttcaagagtatttagtgaggcggagccaagcttggaggaggtaaaggaagcctttgatgtgtttgatgagaacagagatggacttataggcgcagctgatttgcagagagttttgtgcaatttgggtttgaaggggaagtttggattggaggaatgccagaggatgatcaaggcagtggacatgaaccaagatggactagttgattttgaagagttcgtcaaacacatggacaactgcttttaa

Protein Analysis

176

Amino Acids

19.81

Weight (kDa)

4.28

Isoelectric Point (pI)

35.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016836)

Species Orthologous Gene IDs
fragaria_vesca FvH4_4g31200
malus_domestica MD13G1070500.v1.1
prunus_persica Prupe.1G276100_v2.0.a1
pyrus_communis pycom13g06330
rosa_chinensis RchiOBHm_Chr4g0439581
rosa_laevigata RLG00000006256
rosa_multiflora Rmu_sc0002549.1_g000024
rosa_roxburghii Rroxscaffold_5G00380520
rosa_rugosa Rorug04G0320000
rosa_samantha Rh4AG371000 Rh4BG382800 Rh4CG397400 Rh4DG377600
rosa_wichuraiana Rw4G031630

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 308
AclI AACGTT 1 cut(s) 176
AfaI GTAC 1 cut(s) 123
AgsI TTSAA 4 cut(s) 73, 291, 418, 497
AhlI ACTAGT 1 cut(s) 484
AjuI GAANNNNNNNTTGG 4 cut(s) 255, 287, 416, 448
AluBI AGCT 4 cut(s) 26, 76, 318, 383
AluI AGCT 4 cut(s) 26, 76, 318, 383
AlwNI CAGNNNCTG 1 cut(s) 148
ApeKI GCWGC 2 cut(s) 17, 380
AspLEI GCGC 1 cut(s) 380
AspS9I GGNCC 1 cut(s) 81
AsuC2I CCSGG 1 cut(s) 33
AsuHPI GGTGA 1 cut(s) 217
AvaII GGWCC 1 cut(s) 81
BanII GRGCYC 1 cut(s) 38
BbsI GAAGAC 1 cut(s) 270
BbvI GCAGC 2 cut(s) 29, 392
BccI CCATC 4 cut(s) 196, 202, 359, 473
BclI TGATCA 2 cut(s) 139, 453
BcnI CCSGG 1 cut(s) 33
BcuI ACTAGT 1 cut(s) 484
BfaI CTAG 4 cut(s) 14, 50, 182, 485
BisI GCNGC 2 cut(s) 18, 381
BlsI GCNGC 2 cut(s) 19, 382
BmcAI AGTACT 1 cut(s) 123
Bme1390I CCNGG 1 cut(s) 33
Bme18I GGWCC 1 cut(s) 81
BmgT120I GGNCC 1 cut(s) 81
BmiI GGNNCC 2 cut(s) 37, 312
BmrFI CCNGG 1 cut(s) 33
BpiI GAAGAC 1 cut(s) 270
BpuEI CTTGAG 1 cut(s) 102
BpuMI CCSGG 1 cut(s) 33
BsaXI ACNNNNNCTCC 2 cut(s) 234, 264
Bse3DI GCAATG 1 cut(s) 158
BseGI GGATG 1 cut(s) 456
BseMI GCAATG 1 cut(s) 158
BseMII CTCAG 1 cut(s) 102
BseRI GAGGAG 1 cut(s) 338
BseXI GCAGC 2 cut(s) 29, 392
BsiSI CCGG 1 cut(s) 32
BsmI GAATGC 1 cut(s) 446
Bsp1286I GDGCHC 1 cut(s) 38
Bsp143I GATC 2 cut(s) 139, 453
BspACI CCGC 1 cut(s) 308
BspCNI CTCAG 1 cut(s) 103
BspLI GGNNCC 2 cut(s) 37, 312
BsrDI GCAATG 1 cut(s) 158
BssMI GATC 2 cut(s) 139, 453
Bst4CI ACNGT 1 cut(s) 57
Bst6I CTCTTC 1 cut(s) 492
BstDEI CTNAG 1 cut(s) 111
BstF5I GGATG 1 cut(s) 456
BstHHI GCGC 1 cut(s) 380
BstKTI GATC 2 cut(s) 142, 456
BstMBI GATC 2 cut(s) 139, 453
BstMWI GCNNNNNNNGC 1 cut(s) 23
BstSCI CCNGG 1 cut(s) 31
BstV1I GCAGC 2 cut(s) 29, 392
BstV2I GAAGAC 1 cut(s) 270
BtsCI GGATG 1 cut(s) 456
BtsI GCAGTG 1 cut(s) 468
BtsIMutI CAGTG 1 cut(s) 468
CaiI CAGNNNCTG 1 cut(s) 148
CfoI GCGC 1 cut(s) 380
Cfr13I GGNCC 1 cut(s) 81
Csp6I GTAC 1 cut(s) 122
CviAII CATG 3 cut(s) 268, 469, 514
CviQI GTAC 1 cut(s) 122
DdeI CTNAG 1 cut(s) 111
DpnI GATC 2 cut(s) 141, 455
DpnII GATC 2 cut(s) 139, 453
Eam1104I CTCTTC 1 cut(s) 492
EarI CTCTTC 1 cut(s) 492
EciI GGCGGA 1 cut(s) 323
Eco24I GRGCYC 1 cut(s) 38
Eco47I GGWCC 1 cut(s) 81
EcoT38I GRGCYC 1 cut(s) 38
FaeI CATG 3 cut(s) 271, 472, 517
FaiI YATR 6 cut(s) 11, 226, 269, 374, 470, 515
FalI AAGNNNNNCTT 2 cut(s) 323, 355
FatI CATG 3 cut(s) 267, 468, 513
FbaI TGATCA 2 cut(s) 139, 453
Fnu4HI GCNGC 2 cut(s) 18, 381
FokI GGATG 1 cut(s) 463
FriOI GRGCYC 1 cut(s) 38
Fsp4HI GCNGC 2 cut(s) 18, 381
FspBI CTAG 4 cut(s) 14, 50, 182, 485
GlaI GCGC 1 cut(s) 379
GluI GCNGC 2 cut(s) 18, 381
HapII CCGG 1 cut(s) 32
HhaI GCGC 1 cut(s) 380
Hin1II CATG 3 cut(s) 271, 472, 517
Hin6I GCGC 1 cut(s) 378
HinP1I GCGC 1 cut(s) 378
HindIII AAGCTT 1 cut(s) 316
HpaII CCGG 1 cut(s) 32
HphI GGTGA 1 cut(s) 217
Hpy166II GTNNAC 1 cut(s) 466
Hpy188I TCNGA 2 cut(s) 112, 221
Hpy188III TCNNGA 2 cut(s) 79, 291
Hpy8I GTNNAC 1 cut(s) 466
HpyAV CCTTC 2 cut(s) 207, 412
HpyCH4III ACNGT 1 cut(s) 57
HpyCH4IV ACGT 1 cut(s) 176
HpyCH4V TGCA 4 cut(s) 151, 156, 391, 405
HpyF10VI GCNNNNNNNGC 1 cut(s) 23
HpyF3I CTNAG 1 cut(s) 111
HpySE526I ACGT 1 cut(s) 176
Hsp92II CATG 3 cut(s) 271, 472, 517
HspAI GCGC 1 cut(s) 378
Ksp22I TGATCA 2 cut(s) 139, 453
Kzo9I GATC 2 cut(s) 139, 453
LmnI GCTCC 2 cut(s) 41, 310
LpnPI CCDG 5 cut(s) 45, 64, 150, 161, 458
Lsp1109I GCAGC 2 cut(s) 29, 392
MaeI CTAG 4 cut(s) 14, 50, 182, 485
MaeII ACGT 1 cut(s) 176
MalI GATC 2 cut(s) 141, 455
MboI GATC 2 cut(s) 139, 453
MboII GAAGA 5 cut(s) 203, 211, 245, 275, 509
MhlI GDGCHC 1 cut(s) 38
MluCI AATT 2 cut(s) 94, 406
MnlI CCTC 8 cut(s) 50, 126, 232, 298, 316, 319, 430, 441
MseI TTAA 1 cut(s) 529
MspA1I CMGCKG 1 cut(s) 383
MspI CCGG 1 cut(s) 32
MspR9I CCNGG 1 cut(s) 33
Mva1269I GAATGC 1 cut(s) 446
MwoI GCNNNNNNNGC 1 cut(s) 23
NciI CCSGG 1 cut(s) 33
NdeII GATC 2 cut(s) 139, 453
NlaIII CATG 3 cut(s) 271, 472, 517
NlaIV GGNNCC 2 cut(s) 37, 312
PctI GAATGC 1 cut(s) 446
PkrI GCNGC 2 cut(s) 19, 382
Psp1406I AACGTT 1 cut(s) 176
PspN4I GGNNCC 2 cut(s) 37, 312
PspPI GGNCC 1 cut(s) 81
PstNI CAGNNNCTG 1 cut(s) 148
PvuII CAGCTG 1 cut(s) 383
RsaI GTAC 1 cut(s) 123
RsaNI GTAC 1 cut(s) 122
SaqAI TTAA 1 cut(s) 529
SatI GCNGC 2 cut(s) 18, 381
Sau3AI GATC 2 cut(s) 139, 453
Sau96I GGNCC 1 cut(s) 81
ScaI AGTACT 1 cut(s) 123
ScrFI CCNGG 1 cut(s) 33
SduI GDGCHC 1 cut(s) 38
SetI ASST 7 cut(s) 28, 78, 102, 179, 320, 330, 385
SinI GGWCC 1 cut(s) 81
SmlI CTYRAG 1 cut(s) 117
SmoI CTYRAG 1 cut(s) 117
SpeI ACTAGT 1 cut(s) 484
Sse9I AATT 2 cut(s) 94, 406
SsiI CCGC 1 cut(s) 308
SspMI CTAG 4 cut(s) 14, 50, 182, 485
StyD4I CCNGG 1 cut(s) 31
TaaI ACNGT 1 cut(s) 57
TaiI ACGT 1 cut(s) 179
TasI AATT 2 cut(s) 94, 406
TatI WGTACW 1 cut(s) 121
Tru1I TTAA 1 cut(s) 529
Tru9I TTAA 1 cut(s) 529
TscAI CASTG 1 cut(s) 468
TseI GCWGC 2 cut(s) 17, 380
TspDTI ATGAA 2 cut(s) 276, 485
TspRI CASTG 1 cut(s) 468
VpaK11BI GGWCC 1 cut(s) 81
XspI CTAG 4 cut(s) 14, 50, 182, 485
ZrmI AGTACT 1 cut(s) 123
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.