Rmu_sc0002705.1_g000019

Functions as component of the Arp2 3 complex which is involved in regulation of actin polymerization and together with an activating nucleation-promoting factor (NPF) mediates the formation of branched actin networks

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002705.1
Physical Location & Seq
Reverse (-)
69799 .. 71481
1683 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002705.1_g000019.1.cds

Sequence Viewer

Length: 402 bp
atggcagacgaacacgtagaagccgataacgcagaggcaataatcgcccgaatcgagcacaaatctcgaaagatcgaaagcttactcaaacagtacagacccgtcgaagctctcaaaaccgctctcgaaggctcgcctcccaataccagagacgaacgatgcaagtctgcgaattggataatggtgcatagagctattatggctataaaagatgttgatggaatgttttcttctttggatcctgagtactatgatattctcatgaagtacttgtatagaggcttgtctactggagaccgccccacatgcgaccagtgccttcggattcatgaaaaactgacggagagagctggtttgggatgcatactacgttccctttcagacacagtgaatacagtttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Pfam Domains
Protein Families

Protein Analysis

133

Amino Acids

15.11

Weight (kDa)

6.08

Isoelectric Point (pI)

38.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015980)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G01710 AT5G65274
fragaria_vesca FvH4_7g09830
malus_domestica MD02G1216700.v1.1 MD15G1416400.v1.1
prunus_persica Prupe.2G127400_v2.0.a1
pyrus_communis pycom02g17840
rosa_chinensis RchiOBHm_Chr1g0346991
rosa_laevigata RLG00000028765
rosa_multiflora Rmu_sc0002705.1_g000019
rosa_roxburghii Rroxscaffold_4G00307990
rosa_samantha Rh1AG202900 Rh1CG187600 Rh1DG199600
rosa_wichuraiana Rw1G017000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 122
AccI GTMKAC 1 cut(s) 287
AciI CCGC 2 cut(s) 120, 298
AclWI GGATC 2 cut(s) 233, 246
AfaI GTAC 3 cut(s) 95, 248, 269
AflIII ACRYGT 1 cut(s) 13
AluBI AGCT 4 cut(s) 81, 110, 194, 350
AluI AGCT 4 cut(s) 81, 110, 194, 350
Alw21I GWGCWC 1 cut(s) 60
Alw26I GTCTC 2 cut(s) 144, 288
AlwI GGATC 2 cut(s) 233, 246
Asp700I GAANNNNTTC 1 cut(s) 226
BamHI GGATCC 1 cut(s) 238
Bbv12I GWGCWC 1 cut(s) 60
BccI CCATC 1 cut(s) 212
BcgI CGANNNNNNTGC 2 cut(s) 47, 81
BcoDI GTCTC 2 cut(s) 144, 288
BmcAI AGTACT 2 cut(s) 248, 269
BmiI GGNNCC 1 cut(s) 240
BmsI GCATC 2 cut(s) 149, 350
BpmI CTGGAG 1 cut(s) 312
BsaAI YACGTR 1 cut(s) 16
BsaI GGTCTC 1 cut(s) 288
Bse1I ACTGG 2 cut(s) 295, 313
BseGI GGATG 1 cut(s) 365
BseMII CTCAG 1 cut(s) 234
BseNI ACTGG 2 cut(s) 295, 313
BsiHKAI GWGCWC 1 cut(s) 60
BsmAI GTCTC 2 cut(s) 144, 288
BsmBI CGTCTC 1 cut(s) 144
Bso31I GGTCTC 1 cut(s) 288
Bsp1286I GDGCHC 1 cut(s) 60
Bsp143I GATC 2 cut(s) 72, 238
BspACI CCGC 2 cut(s) 120, 298
BspCNI CTCAG 1 cut(s) 235
BspHI TCATGA 2 cut(s) 261, 328
BspLI GGNNCC 1 cut(s) 240
BspPI GGATC 2 cut(s) 233, 246
BspTNI GGTCTC 1 cut(s) 288
BsrBI CCGCTC 1 cut(s) 122
BsrI ACTGG 2 cut(s) 295, 313
BssMI GATC 2 cut(s) 72, 238
Bst4CI ACNGT 3 cut(s) 93, 388, 397
BstBAI YACGTR 1 cut(s) 16
BstC8I GCNNGC 1 cut(s) 134
BstDEI CTNAG 1 cut(s) 243
BstF5I GGATG 1 cut(s) 365
BstKTI GATC 2 cut(s) 75, 241
BstMAI GTCTC 2 cut(s) 144, 288
BstMBI GATC 2 cut(s) 72, 238
BstMWI GCNNNNNNNGC 5 cut(s) 29, 44, 200, 306, 315
BstNSI RCATGY 1 cut(s) 309
BstX2I RGATCY 1 cut(s) 238
BstYI RGATCY 1 cut(s) 238
BtsCI GGATG 1 cut(s) 365
BtsIMutI CAGTG 2 cut(s) 320, 393
Cac8I GCNNGC 1 cut(s) 134
CciI TCATGA 2 cut(s) 261, 328
Csp6I GTAC 3 cut(s) 94, 247, 268
CviAII CATG 3 cut(s) 262, 306, 329
CviJI RGCY 8 cut(s) 23, 81, 110, 132, 194, 203, 282, 350
CviKI_1 RGCY 8 cut(s) 23, 81, 110, 132, 194, 203, 282, 350
CviQI GTAC 3 cut(s) 94, 247, 268
DdeI CTNAG 1 cut(s) 243
DpnI GATC 2 cut(s) 74, 240
DpnII GATC 2 cut(s) 72, 238
Eco31I GGTCTC 1 cut(s) 288
EcoT22I ATGCAT 1 cut(s) 365
Esp3I CGTCTC 1 cut(s) 144
FaeI CATG 3 cut(s) 265, 309, 332
FaiI YATR 9 cut(s) 189, 200, 206, 252, 263, 276, 307, 330, 365
FatI CATG 3 cut(s) 261, 305, 328
FblI GTMKAC 1 cut(s) 287
FokI GGATG 1 cut(s) 372
GsuI CTGGAG 1 cut(s) 312
Hin1II CATG 3 cut(s) 265, 309, 332
HindIII AAGCTT 1 cut(s) 79
HinfI GANTC 2 cut(s) 51, 325
Hpy166II GTNNAC 1 cut(s) 288
Hpy188I TCNGA 2 cut(s) 324, 382
Hpy188III TCNNGA 5 cut(s) 66, 125, 242, 262, 329
Hpy8I GTNNAC 1 cut(s) 288
Hpy99I CGWCG 1 cut(s) 107
HpyAV CCTTC 2 cut(s) 122, 329
HpyCH4III ACNGT 3 cut(s) 93, 388, 397
HpyCH4IV ACGT 2 cut(s) 15, 370
HpyCH4V TGCA 3 cut(s) 162, 187, 363
HpyF10VI GCNNNNNNNGC 5 cut(s) 29, 44, 200, 306, 315
HpyF3I CTNAG 1 cut(s) 243
HpySE526I ACGT 2 cut(s) 15, 370
Hsp92II CATG 3 cut(s) 265, 309, 332
Kzo9I GATC 2 cut(s) 72, 238
LpnPI CCDG 5 cut(s) 160, 255, 276, 326, 336
LweI GCATC 2 cut(s) 149, 350
MaeII ACGT 2 cut(s) 15, 370
MalI GATC 2 cut(s) 74, 240
MbiI CCGCTC 1 cut(s) 122
MboI GATC 2 cut(s) 72, 238
MboII GAAGA 1 cut(s) 222
MflI RGATCY 1 cut(s) 238
MhlI GDGCHC 1 cut(s) 60
MluCI AATT 1 cut(s) 172
MnlI CCTC 3 cut(s) 28, 147, 272
Mph1103I ATGCAT 1 cut(s) 365
MroXI GAANNNNTTC 1 cut(s) 226
MwoI GCNNNNNNNGC 5 cut(s) 29, 44, 200, 306, 315
NdeII GATC 2 cut(s) 72, 238
NlaIII CATG 3 cut(s) 265, 309, 332
NlaIV GGNNCC 1 cut(s) 240
NsiI ATGCAT 1 cut(s) 365
NspI RCATGY 1 cut(s) 309
PagI TCATGA 2 cut(s) 261, 328
PcsI WCGNNNNNNNCGW 2 cut(s) 21, 51
PdmI GAANNNNTTC 1 cut(s) 226
PfeI GAWTC 2 cut(s) 51, 325
Ppu21I YACGTR 1 cut(s) 16
PspN4I GGNNCC 1 cut(s) 240
PsuI RGATCY 1 cut(s) 238
RsaI GTAC 3 cut(s) 95, 248, 269
RsaNI GTAC 3 cut(s) 94, 247, 268
Sau3AI GATC 2 cut(s) 72, 238
ScaI AGTACT 2 cut(s) 248, 269
SduI GDGCHC 1 cut(s) 60
SetI ASST 6 cut(s) 18, 83, 112, 196, 352, 373
SfaNI GCATC 2 cut(s) 149, 350
Sse9I AATT 1 cut(s) 172
SsiI CCGC 2 cut(s) 120, 298
TaaI ACNGT 3 cut(s) 93, 388, 397
TaiI ACGT 2 cut(s) 18, 373
TaqI TCGA 5 cut(s) 54, 67, 75, 105, 126
TasI AATT 1 cut(s) 172
TatI WGTACW 3 cut(s) 93, 246, 267
TfiI GAWTC 2 cut(s) 51, 325
TscAI CASTG 2 cut(s) 320, 393
TspDTI ATGAA 3 cut(s) 278, 317, 345
TspGWI ACGGA 1 cut(s) 356
TspRI CASTG 2 cut(s) 320, 393
XceI RCATGY 1 cut(s) 309
XmiI GTMKAC 1 cut(s) 287
XmnI GAANNNNTTC 1 cut(s) 226
ZrmI AGTACT 2 cut(s) 248, 269
Zsp2I ATGCAT 1 cut(s) 365
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.