Rmu_sc0002784.1_g000019

Protein DOWNSTREAM OF

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002784.1
Physical Location & Seq
Reverse (-)
91132 .. 92122
991 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002784.1_g000019.1.cds

Sequence Viewer

Length: 489 bp
atggcagtatctagggtgctggtgttgcttgctctctgcgtgcttccggcacttgccagtgcaaaaaccgtgggcaaacccttccatgtccaaggtcgcgtctactgcgacacttgccgctgtggtttcgagacctctgccaccacttatattgccggtgcaagggtgagaattgagtgcaaatacaggaaaagcttgagccttgcatacagtgtagagggcgtgaccgacgcaactggaacataccacattttggttgaagacgaccacgaggaccagatttgcgaaacggtcctcatcagcagcccaatcagtgactgtaaatcagctgaccccggacgtagccgttccaacgtggtacttacccgcttcaacggcgttgttaagaccaagcgttttgcaaacaacatggggttcttcaaggatcaggaattgcctgggtgttcccaactgctcaagcaatacttgaactacgatcagcaggaatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

162

Amino Acids

17.91

Weight (kDa)

8.1

Isoelectric Point (pI)

40.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016738)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g21330
malus_domestica MD15G1327700.v1.1 MD15G1327800.v1.1
prunus_persica Prupe.6G181300_v2.0.a1
rosa_chinensis RchiOBHm_Chr2g0115161
rosa_laevigata RLG00000018163
rosa_multiflora Rmu_sc0002784.1_g000019
rosa_roxburghii Rroxscaffold_2G00130640
rosa_rugosa Rorug02G0194100
rosa_samantha Rh2AG252600 Rh2BG262200 Rh2CG257100 Rh2DG260800
rosa_wichuraiana Rw2G019700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 253
AccI GTMKAC 1 cut(s) 102
AccII CGCG 1 cut(s) 99
AciI CCGC 2 cut(s) 118, 367
AclWI GGATC 1 cut(s) 432
AfaI GTAC 1 cut(s) 360
AfiI CCNNNNNNNGG 2 cut(s) 162, 253
AgsI TTSAA 4 cut(s) 260, 373, 421, 469
AjnI CCWGG 1 cut(s) 436
AluBI AGCT 2 cut(s) 195, 329
AluI AGCT 2 cut(s) 195, 329
Alw26I GTCTC 1 cut(s) 125
AlwI GGATC 1 cut(s) 432
AlwNI CAGNNNCTG 1 cut(s) 318
ApeKI GCWGC 1 cut(s) 303
AspS9I GGNCC 2 cut(s) 274, 292
AsuC2I CCSGG 1 cut(s) 336
AsuHPI GGTGA 1 cut(s) 178
AvaII GGWCC 2 cut(s) 274, 292
BauI CACGAG 1 cut(s) 269
BbsI GAAGAC 1 cut(s) 267
BbvI GCAGC 1 cut(s) 315
BceAI ACGGC 2 cut(s) 330, 391
BcgI CGANNNNNNTGC 2 cut(s) 119, 153
BciT130I CCWGG 1 cut(s) 438
BcnI CCSGG 1 cut(s) 336
BcoDI GTCTC 1 cut(s) 125
BfaI CTAG 1 cut(s) 12
BisI GCNGC 2 cut(s) 118, 304
BlsI GCNGC 2 cut(s) 119, 305
Bme1390I CCNGG 2 cut(s) 336, 438
Bme18I GGWCC 2 cut(s) 274, 292
BmgT120I GGNCC 2 cut(s) 274, 292
BmrFI CCNGG 2 cut(s) 336, 438
BpiI GAAGAC 1 cut(s) 267
BpuEI CTTGAG 2 cut(s) 217, 440
BpuMI CCSGG 1 cut(s) 336
BsaI GGTCTC 1 cut(s) 125
BsaJI CCNNGG 4 cut(s) 69, 91, 334, 437
Bsc4I CCNNNNNNNGG 2 cut(s) 162, 253
Bse118I RCCGGY 1 cut(s) 155
Bse1I ACTGG 2 cut(s) 57, 241
BseBI CCWGG 1 cut(s) 438
BseDI CCNNGG 4 cut(s) 69, 91, 334, 437
BseLI CCNNNNNNNGG 2 cut(s) 162, 253
BseNI ACTGG 2 cut(s) 57, 241
BseXI GCAGC 1 cut(s) 315
Bsh1236I CGCG 1 cut(s) 99
BsiSI CCGG 3 cut(s) 47, 156, 336
BslI CCNNNNNNNGG 2 cut(s) 162, 253
BsmAI GTCTC 1 cut(s) 125
Bso31I GGTCTC 1 cut(s) 125
Bsp143I GATC 2 cut(s) 424, 475
BspACI CCGC 2 cut(s) 118, 367
BspFNI CGCG 1 cut(s) 99
BspPI GGATC 1 cut(s) 432
BspTNI GGTCTC 1 cut(s) 125
BsrFI RCCGGY 1 cut(s) 155
BsrI ACTGG 2 cut(s) 57, 241
BssAI RCCGGY 1 cut(s) 155
BssECI CCNNGG 4 cut(s) 69, 91, 334, 437
BssMI GATC 2 cut(s) 424, 475
BssSI CACGAG 1 cut(s) 269
BssT1I CCWWGG 1 cut(s) 91
Bst2BI CACGAG 1 cut(s) 269
Bst2UI CCWGG 1 cut(s) 438
Bst4CI ACNGT 4 cut(s) 70, 212, 292, 320
BstC8I GCNNGC 2 cut(s) 30, 41
BstDSI CCRYGG 1 cut(s) 69
BstFNI CGCG 1 cut(s) 99
BstKTI GATC 2 cut(s) 427, 478
BstMAI GTCTC 1 cut(s) 125
BstMBI GATC 2 cut(s) 424, 475
BstMWI GCNNNNNNNGC 4 cut(s) 25, 105, 114, 375
BstNI CCWGG 1 cut(s) 438
BstSCI CCNGG 2 cut(s) 334, 436
BstUI CGCG 1 cut(s) 99
BstV1I GCAGC 1 cut(s) 315
BstV2I GAAGAC 1 cut(s) 267
BtgI CCRYGG 1 cut(s) 69
BtsIMutI CAGTG 3 cut(s) 64, 217, 319
Cac8I GCNNGC 2 cut(s) 30, 41
CaiI CAGNNNCTG 1 cut(s) 318
Cfr10I RCCGGY 1 cut(s) 155
Cfr13I GGNCC 2 cut(s) 274, 292
CseI GACGC 2 cut(s) 88, 239
Csp6I GTAC 1 cut(s) 359
CspCI CAANNNNNGTGG 4 cut(s) 51, 86, 133, 168
CviAII CATG 2 cut(s) 86, 409
CviJI RGCY 5 cut(s) 195, 201, 306, 329, 345
CviKI_1 RGCY 5 cut(s) 195, 201, 306, 329, 345
CviQI GTAC 1 cut(s) 359
DpnI GATC 2 cut(s) 426, 477
DpnII GATC 2 cut(s) 424, 475
Eco130I CCWWGG 1 cut(s) 91
Eco31I GGTCTC 1 cut(s) 125
Eco47I GGWCC 2 cut(s) 274, 292
EcoRII CCWGG 1 cut(s) 436
EcoT14I CCWWGG 1 cut(s) 91
ErhI CCWWGG 1 cut(s) 91
FaeI CATG 2 cut(s) 89, 412
FaiI YATR 5 cut(s) 87, 150, 208, 244, 410
FalI AAGNNNNNCTT 2 cut(s) 449, 481
FatI CATG 2 cut(s) 85, 408
FauI CCCGC 1 cut(s) 374
FblI GTMKAC 1 cut(s) 102
Fnu4HI GCNGC 2 cut(s) 118, 304
Fsp4HI GCNGC 2 cut(s) 118, 304
FspBI CTAG 1 cut(s) 12
GluI GCNGC 2 cut(s) 118, 304
HapII CCGG 3 cut(s) 47, 156, 336
HgaI GACGC 2 cut(s) 88, 239
Hin1II CATG 2 cut(s) 89, 412
HindIII AAGCTT 1 cut(s) 193
HpaII CCGG 3 cut(s) 47, 156, 336
HphI GGTGA 1 cut(s) 178
Hpy166II GTNNAC 1 cut(s) 103
Hpy188III TCNNGA 2 cut(s) 130, 428
Hpy8I GTNNAC 1 cut(s) 103
Hpy99I CGWCG 1 cut(s) 233
HpyAV CCTTC 1 cut(s) 91
HpyCH4III ACNGT 4 cut(s) 70, 212, 292, 320
HpyCH4IV ACGT 2 cut(s) 340, 354
HpyCH4V TGCA 5 cut(s) 62, 161, 180, 206, 401
HpyF10VI GCNNNNNNNGC 4 cut(s) 25, 105, 114, 375
HpySE526I ACGT 2 cut(s) 340, 354
Hsp92II CATG 2 cut(s) 89, 412
Kzo9I GATC 2 cut(s) 424, 475
Lsp1109I GCAGC 1 cut(s) 315
MaeI CTAG 1 cut(s) 12
MaeII ACGT 2 cut(s) 340, 354
MaeIII GTNAC 2 cut(s) 223, 314
MalI GATC 2 cut(s) 426, 477
MboI GATC 2 cut(s) 424, 475
MboII GAAGA 2 cut(s) 272, 409
MluCI AATT 2 cut(s) 171, 431
MmeI TCCRAC 1 cut(s) 375
MnlI CCTC 4 cut(s) 145, 211, 265, 305
MseI TTAA 1 cut(s) 384
MspA1I CMGCKG 2 cut(s) 120, 329
MspI CCGG 3 cut(s) 47, 156, 336
MspR9I CCNGG 2 cut(s) 336, 438
MvaI CCWGG 1 cut(s) 438
MvnI CGCG 1 cut(s) 99
MwoI GCNNNNNNNGC 4 cut(s) 25, 105, 114, 375
NciI CCSGG 1 cut(s) 336
NdeII GATC 2 cut(s) 424, 475
NlaIII CATG 2 cut(s) 89, 412
NmuCI GTSAC 2 cut(s) 223, 314
PflMI CCANNNNNTGG 1 cut(s) 253
PkrI GCNGC 2 cut(s) 119, 305
Psp6I CCWGG 1 cut(s) 436
PspGI CCWGG 1 cut(s) 436
PspPI GGNCC 2 cut(s) 274, 292
PstNI CAGNNNCTG 1 cut(s) 318
PvuII CAGCTG 1 cut(s) 329
RsaI GTAC 1 cut(s) 360
RsaNI GTAC 1 cut(s) 359
SaqAI TTAA 1 cut(s) 384
SatI GCNGC 2 cut(s) 118, 304
Sau3AI GATC 2 cut(s) 424, 475
Sau96I GGNCC 2 cut(s) 274, 292
ScrFI CCNGG 2 cut(s) 336, 438
SetI ASST 6 cut(s) 97, 137, 197, 331, 343, 357
SinI GGWCC 2 cut(s) 274, 292
SmlI CTYRAG 2 cut(s) 196, 455
SmoI CTYRAG 2 cut(s) 196, 455
Sse9I AATT 2 cut(s) 171, 431
SsiI CCGC 2 cut(s) 118, 367
SspMI CTAG 1 cut(s) 12
StyD4I CCNGG 2 cut(s) 334, 436
StyI CCWWGG 1 cut(s) 91
TaaI ACNGT 4 cut(s) 70, 212, 292, 320
TaiI ACGT 2 cut(s) 343, 357
TaqI TCGA 1 cut(s) 129
TaqII GACCGA 1 cut(s) 242
TasI AATT 2 cut(s) 171, 431
TauI GCSGC 1 cut(s) 120
Tru1I TTAA 1 cut(s) 384
Tru9I TTAA 1 cut(s) 384
TscAI CASTG 3 cut(s) 64, 217, 319
TseFI GTSAC 2 cut(s) 223, 314
TseI GCWGC 1 cut(s) 303
Tsp45I GTSAC 2 cut(s) 223, 314
TspRI CASTG 3 cut(s) 64, 217, 319
Van91I CCANNNNNTGG 1 cut(s) 253
VpaK11BI GGWCC 2 cut(s) 274, 292
XmiI GTMKAC 1 cut(s) 102
XspI CTAG 1 cut(s) 12
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.