Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002858.1

Orthogroup ID

OG0018105

Physical Location & Seq

Genomic Coordinates Reverse (-)

17692 .. 17955

Gene Structure 264 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002858.1_g000004.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 264 bp

atgaggtgcaaatggctagcagagcttcttggaggcacattcaaggtaccaagcataaaagaaatggagaaagatgtgaaacaatgggatgagtatgccaagcgatactccagaaaatactatcggagatcatgcgtcggagcgcttcacatatggtacaatgaccaattgtgcaaggatatgggatggaatcccaaaaggaagaagggacttcttgctgaactatttgagccttatggcccaacggattatatttcctcttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0001666 GO:0002218 GO:0002253 GO:0002376 GO:0002682 GO:0002684 GO:0003674 GO:0003824 GO:0004497 GO:0006950 GO:0006952 GO:0006955 GO:0007154 GO:0007165 GO:0008150 GO:0008152 GO:0008219 GO:0009605 GO:0009607 GO:0009617 GO:0009620 GO:0009626 GO:0009627 GO:0009628 GO:0009814 GO:0009870 GO:0009987 GO:0010204 GO:0012501 GO:0016491 GO:0023052 GO:0031347 GO:0031349 GO:0033554 GO:0034050 GO:0036293 GO:0036294 GO:0042221 GO:0042742 GO:0043207 GO:0045087 GO:0045088 GO:0045089 GO:0048518 GO:0048583 GO:0048584 GO:0050776 GO:0050778 GO:0050789 GO:0050794 GO:0050832 GO:0050896 GO:0051704 GO:0051707 GO:0051716 GO:0055114 GO:0065007 GO:0070482 GO:0070887 GO:0071453 GO:0071456 GO:0080134 GO:0098542

KEGG Pathways

Metabolic & Signaling

ko00982 ko01120 map00982 map01120

Pfam Domains

Protein Families

FMO-like

Protein Analysis

87

Amino Acids

10.42

Weight (kDa)

9.3

Isoelectric Point (pI)

49.07

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018105)

Species	Orthologous Gene IDs
malus_domestica	MD16G1203900.v1.1
prunus_persica	Prupe.8G177000_v2.0.a1
pyrus_communis	pycom10g11770
rosa_chinensis	RchiOBHm_Chr6g0280211
rosa_multiflora	Rmu_sc0000757.1_g000010 Rmu_sc0002826.1_g000028 Rmu_sc0002858.1_g000004 Rmu_sc0025333.1_g000001
rosa_samantha	Rh6AG242300 Rh6BG244700 Rh6CG246300

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc65I	GGTACC	1 cut(s)	46
AccB1I	GGYRCC	1 cut(s)	46
AfaI	GTAC	2 cut(s)	48, 158
AfeI	AGCGCT	1 cut(s)	144
AgsI	TTSAA	1 cut(s)	43
AluBI	AGCT	1 cut(s)	25
AluI	AGCT	1 cut(s)	25
Aor51HI	AGCGCT	1 cut(s)	144
AoxI	GGCC	1 cut(s)	238
Asp718I	GGTACC	1 cut(s)	46
AspLEI	GCGC	1 cut(s)	145
AspS9I	GGNCC	1 cut(s)	239
AsuNHI	GCTAGC	1 cut(s)	16
BanI	GGYRCC	1 cut(s)	46
BccI	CCATC	1 cut(s)	180
BfaI	CTAG	1 cut(s)	17
BfoI	RGCGCY	1 cut(s)	146
BmgT120I	GGNCC	1 cut(s)	239
BmiI	GGNNCC	1 cut(s)	48
BmtI	GCTAGC	1 cut(s)	20
BpmI	CTGGAG	1 cut(s)	94
BseGI	GGATG	2 cut(s)	94, 191
BshFI	GGCC	1 cut(s)	240
BshNI	GGYRCC	1 cut(s)	46
BslFI	GGGAC	1 cut(s)	222
BsmFI	GGGAC	1 cut(s)	222
BsnI	GGCC	1 cut(s)	240
Bsp143I	GATC	1 cut(s)	128
BspANI	GGCC	1 cut(s)	240
BspLI	GGNNCC	1 cut(s)	48
BspOI	GCTAGC	1 cut(s)	20
BspT107I	GGYRCC	1 cut(s)	46
BssMI	GATC	1 cut(s)	128
BstC8I	GCNNGC	1 cut(s)	18
BstF5I	GGATG	2 cut(s)	94, 191
BstH2I	RGCGCY	1 cut(s)	146
BstHHI	GCGC	1 cut(s)	145
BstKTI	GATC	1 cut(s)	131
BstMBI	GATC	1 cut(s)	128
BstMWI	GCNNNNNNNGC	1 cut(s)	22
BsuRI	GGCC	1 cut(s)	240
BtsCI	GGATG	2 cut(s)	94, 191
Cac8I	GCNNGC	1 cut(s)	18
CfoI	GCGC	1 cut(s)	145
Cfr13I	GGNCC	1 cut(s)	239
CseI	GACGC	1 cut(s)	124
Csp6I	GTAC	2 cut(s)	47, 157
CviAII	CATG	1 cut(s)	132
CviJI	RGCY	4 cut(s)	16, 25, 232, 240
CviKI_1	RGCY	4 cut(s)	16, 25, 232, 240
CviQI	GTAC	2 cut(s)	47, 157
DpnI	GATC	1 cut(s)	130
DpnII	GATC	1 cut(s)	128
Eco47III	AGCGCT	1 cut(s)	144
FaeI	CATG	1 cut(s)	135
FaiI	YATR	8 cut(s)	56, 96, 133, 152, 154, 182, 237, 252
FaqI	GGGAC	1 cut(s)	222
FatI	CATG	1 cut(s)	131
FauNDI	CATATG	1 cut(s)	152
FokI	GGATG	2 cut(s)	101, 198
FspBI	CTAG	1 cut(s)	17
GlaI	GCGC	1 cut(s)	144
GsuI	CTGGAG	1 cut(s)	94
HaeII	RGCGCY	1 cut(s)	146
HaeIII	GGCC	1 cut(s)	240
HgaI	GACGC	1 cut(s)	124
HhaI	GCGC	1 cut(s)	145
Hin1II	CATG	1 cut(s)	135
Hin6I	GCGC	1 cut(s)	143
HinP1I	GCGC	1 cut(s)	143
HinfI	GANTC	1 cut(s)	190
Hpy188I	TCNGA	2 cut(s)	126, 140
Hpy188III	TCNNGA	1 cut(s)	111
Hpy99I	CGWCG	1 cut(s)	140
HpyAV	CCTTC	1 cut(s)	199
HpyCH4V	TGCA	2 cut(s)	9, 174
HpyF10VI	GCNNNNNNNGC	1 cut(s)	22
Hsp92II	CATG	1 cut(s)	135
HspAI	GCGC	1 cut(s)	143
KpnI	GGTACC	1 cut(s)	50
Kzo9I	GATC	1 cut(s)	128
LmnI	GCTCC	1 cut(s)	140
LpnPI	CCDG	1 cut(s)	124
MaeI	CTAG	1 cut(s)	17
MalI	GATC	1 cut(s)	130
MboI	GATC	1 cut(s)	128
MboII	GAAGA	1 cut(s)	214
MfeI	CAATTG	1 cut(s)	167
MluCI	AATT	1 cut(s)	167
MmeI	TCCRAC	1 cut(s)	118
MnlI	CCTC	1 cut(s)	26
MseI	TTAA	1 cut(s)	262
MunI	CAATTG	1 cut(s)	167
MwoI	GCNNNNNNNGC	1 cut(s)	22
NdeI	CATATG	1 cut(s)	152
NdeII	GATC	1 cut(s)	128
NheI	GCTAGC	1 cut(s)	16
NlaIII	CATG	1 cut(s)	135
NlaIV	GGNNCC	1 cut(s)	48
PfeI	GAWTC	1 cut(s)	190
PspN4I	GGNNCC	1 cut(s)	48
PspPI	GGNCC	1 cut(s)	239
RsaI	GTAC	2 cut(s)	48, 158
RsaNI	GTAC	2 cut(s)	47, 157
SaqAI	TTAA	1 cut(s)	262
Sau3AI	GATC	1 cut(s)	128
Sau96I	GGNCC	1 cut(s)	239
SetI	ASST	3 cut(s)	8, 27, 48
SgeI	CNNG	9 cut(s)	29, 41, 55, 63, 112, 123, 144, 187, 227
Sse9I	AATT	1 cut(s)	167
SspMI	CTAG	1 cut(s)	17
TasI	AATT	1 cut(s)	167
TfiI	GAWTC	1 cut(s)	190
Tru1I	TTAA	1 cut(s)	262
Tru9I	TTAA	1 cut(s)	262
TspGWI	ACGGA	1 cut(s)	260
XspI	CTAG	1 cut(s)	17

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.