Rh6AG242300

flavin-containing monooxygenase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
Physical Location & Seq
Reverse (-)
43007932 .. 43008141
210 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG242300.1

Sequence Viewer

Length: 210 bp
ATGGAAAAGGATGTGAAGAAATGGGACGAATATGCGAAGCGATATGGTGGAGAATACTATCGGAGATCATGCATCAGTTCCCTTCATGTATGGTACAACGACCAGTTGTGCAAGGATATGGGATGGAACCCCAAGAGGAAGAAGGGACTGCTTGCTGAACTTTTTGAGCCTTATGGTCCAATGGATTATGTTTCCCCTTTAAATAGTTAA

Protein Analysis

69

Amino Acids

8.29

Weight (kDa)

8.55

Isoelectric Point (pI)

50.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018105)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 95
AspS9I GGNCC 1 cut(s) 176
AvaII GGWCC 1 cut(s) 176
BccI CCATC 1 cut(s) 117
Bme18I GGWCC 1 cut(s) 176
BmgT120I GGNCC 1 cut(s) 176
BmiI GGNNCC 1 cut(s) 128
BmsI GCATC 1 cut(s) 81
Bse1I ACTGG 1 cut(s) 103
BseGI GGATG 2 cut(s) 16, 128
BseNI ACTGG 1 cut(s) 103
BslFI GGGAC 2 cut(s) 38, 159
BsmFI GGGAC 2 cut(s) 38, 159
Bsp143I GATC 1 cut(s) 65
BspLI GGNNCC 1 cut(s) 128
BsrI ACTGG 1 cut(s) 103
BssMI GATC 1 cut(s) 65
BstC8I GCNNGC 1 cut(s) 153
BstF5I GGATG 2 cut(s) 16, 128
BstKTI GATC 1 cut(s) 68
BstMBI GATC 1 cut(s) 65
BtsCI GGATG 2 cut(s) 16, 128
Cac8I GCNNGC 1 cut(s) 153
Cfr13I GGNCC 1 cut(s) 176
Csp6I GTAC 1 cut(s) 94
CviAII CATG 2 cut(s) 69, 86
CviJI RGCY 1 cut(s) 169
CviKI_1 RGCY 1 cut(s) 169
CviQI GTAC 1 cut(s) 94
DpnI GATC 1 cut(s) 67
DpnII GATC 1 cut(s) 65
DraI TTTAAA 1 cut(s) 201
Eco47I GGWCC 1 cut(s) 176
EcoT22I ATGCAT 1 cut(s) 74
FaeI CATG 2 cut(s) 72, 89
FaiI YATR 8 cut(s) 33, 45, 70, 87, 91, 119, 174, 189
FaqI GGGAC 2 cut(s) 38, 159
FatI CATG 2 cut(s) 68, 85
FokI GGATG 2 cut(s) 23, 135
Hin1II CATG 2 cut(s) 72, 89
Hpy188I TCNGA 1 cut(s) 63
HpyAV CCTTC 2 cut(s) 92, 136
HpyCH4V TGCA 2 cut(s) 72, 111
Hsp92II CATG 2 cut(s) 72, 89
Kzo9I GATC 1 cut(s) 65
LpnPI CCDG 1 cut(s) 116
LweI GCATC 1 cut(s) 81
MalI GATC 1 cut(s) 67
MboI GATC 1 cut(s) 65
MboII GAAGA 2 cut(s) 28, 151
MnlI CCTC 1 cut(s) 129
Mph1103I ATGCAT 1 cut(s) 74
MseI TTAA 2 cut(s) 200, 208
NdeII GATC 1 cut(s) 65
NlaIII CATG 2 cut(s) 72, 89
NlaIV GGNNCC 1 cut(s) 128
NsiI ATGCAT 1 cut(s) 74
PspN4I GGNNCC 1 cut(s) 128
PspPI GGNCC 1 cut(s) 176
RsaI GTAC 1 cut(s) 95
RsaNI GTAC 1 cut(s) 94
SaqAI TTAA 2 cut(s) 200, 208
Sau3AI GATC 1 cut(s) 65
Sau96I GGNCC 1 cut(s) 176
SfaNI GCATC 1 cut(s) 81
SgeI CNNG 6 cut(s) 81, 98, 115, 124, 145, 164
SinI GGWCC 1 cut(s) 176
Tru1I TTAA 2 cut(s) 200, 208
Tru9I TTAA 2 cut(s) 200, 208
TspDTI ATGAA 1 cut(s) 74
VpaK11BI GGWCC 1 cut(s) 176
Zsp2I ATGCAT 1 cut(s) 74
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.