Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003074.1

Orthogroup ID

OG0016875

Physical Location & Seq

Genomic Coordinates Reverse (-)

40357 .. 40767

Gene Structure 411 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003074.1_g000011.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 411 bp

atggatatgatgaacatgacgatgaacagtacgactatgactatgcagatgagtttctactggggcagaaacgtcactatcctcttctccaagtggcctggaaacgaccaacataacccaggcatgtacatattggccctcttctttgtgtttgctatagcctttgccatggaagctttgtccgtctggccgactatcaagcccagcaggagttcggtagtcgcaggcctggctcaggcttttctttacgccattcgtatcagcttgggttactttgtgatgcttgccgttatgtcctacaacattggaatcttcatagcagctgtggcgggccacacggttgggttctttgttgccaaggctagtgctctttccattaccaagcctccgggacccgaaccttcattctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464

KEGG Pathways

Metabolic & Signaling

ko01524 ko04978 map01524 map04978

Pfam Domains

Protein Families

Ctr

Protein Analysis

136

Amino Acids

14.97

Weight (kDa)

9.45

Isoelectric Point (pI)

35.65

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016875)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_6g12620
malus_domestica	MD04G1140500.v1.1 MD12G1155900.v1.1
prunus_persica	Prupe.6G265600_v2.0.a1
pyrus_communis	pycom04g12810
rosa_chinensis	RchiOBHm_Chr3g0464471
rosa_laevigata	RLG00000024694
rosa_multiflora	Rmu_sc0003074.1_g000011
rosa_roxburghii	Rroxscaffold_6G00415640
rosa_rugosa	Rorug03G0072400
rosa_samantha	Rh3BG134600 Rh3CG137100 Rh3DG135900
rosa_wichuraiana	Rw3G011000

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	329
AcoI	YGGCCR	1 cut(s)	188
AfaI	GTAC	2 cut(s)	31, 128
AfiI	CCNNNNNNNGG	1 cut(s)	235
AjnI	CCWGG	3 cut(s)	97, 118, 228
AluBI	AGCT	3 cut(s)	176, 264, 323
AluI	AGCT	3 cut(s)	176, 264, 323
Alw21I	GWGCWC	1 cut(s)	370
AoxI	GGCC	5 cut(s)	95, 135, 188, 226, 331
ApeKI	GCWGC	1 cut(s)	320
AspS9I	GGNCC	3 cut(s)	136, 331, 392
AsuC2I	CCSGG	1 cut(s)	390
AvaII	GGWCC	1 cut(s)	392
Bbv12I	GWGCWC	1 cut(s)	370
BbvI	GCAGC	1 cut(s)	332
BceAI	ACGGC	1 cut(s)	272
BciT130I	CCWGG	3 cut(s)	99, 120, 230
BcnI	CCSGG	1 cut(s)	390
BfaI	CTAG	1 cut(s)	363
BfmI	CTRYAG	1 cut(s)	156
BisI	GCNGC	1 cut(s)	321
BlsI	GCNGC	1 cut(s)	322
Bme1390I	CCNGG	4 cut(s)	99, 120, 230, 390
Bme18I	GGWCC	1 cut(s)	392
BmgT120I	GGNCC	3 cut(s)	136, 331, 392
BmiI	GGNNCC	2 cut(s)	393, 394
BmrFI	CCNGG	4 cut(s)	99, 120, 230, 390
BmrI	ACTGGG	1 cut(s)	70
BmsI	GCATC	1 cut(s)	270
BmuI	ACTGGG	1 cut(s)	70
Bpu10I	CCTNAGC	1 cut(s)	234
BpuMI	CCSGG	1 cut(s)	390
BsaJI	CCNNGG	3 cut(s)	118, 168, 357
BsaXI	ACNNNNNCTCC	2 cut(s)	370, 400
Bsc4I	CCNNNNNNNGG	1 cut(s)	235
Bse1I	ACTGG	1 cut(s)	65
BseBI	CCWGG	3 cut(s)	99, 120, 230
BseDI	CCNNGG	3 cut(s)	118, 168, 357
BseLI	CCNNNNNNNGG	1 cut(s)	235
BseMII	CTCAG	1 cut(s)	248
BseNI	ACTGG	1 cut(s)	65
BseXI	GCAGC	1 cut(s)	332
BseYI	CCCAGC	1 cut(s)	203
BshFI	GGCC	5 cut(s)	97, 137, 190, 228, 333
BsiHKAI	GWGCWC	1 cut(s)	370
BsiSI	CCGG	1 cut(s)	389
BslFI	GGGAC	1 cut(s)	405
BslI	CCNNNNNNNGG	1 cut(s)	235
BsmFI	GGGAC	1 cut(s)	405
BsnI	GGCC	5 cut(s)	97, 137, 190, 228, 333
Bsp1286I	GDGCHC	1 cut(s)	370
Bsp1407I	TGTACA	1 cut(s)	126
Bsp19I	CCATGG	1 cut(s)	168
BspACI	CCGC	1 cut(s)	329
BspANI	GGCC	5 cut(s)	97, 137, 190, 228, 333
BspCNI	CTCAG	1 cut(s)	247
BspLI	GGNNCC	2 cut(s)	393, 394
BsrGI	TGTACA	1 cut(s)	126
BsrI	ACTGG	1 cut(s)	65
BssECI	CCNNGG	3 cut(s)	118, 168, 357
BssT1I	CCWWGG	2 cut(s)	168, 357
Bst2UI	CCWGG	3 cut(s)	99, 120, 230
Bst4CI	ACNGT	2 cut(s)	29, 340
Bst6I	CTCTTC	2 cut(s)	89, 146
BstAUI	TGTACA	1 cut(s)	126
BstC8I	GCNNGC	3 cut(s)	226, 285, 331
BstDEI	CTNAG	1 cut(s)	234
BstDSI	CCRYGG	1 cut(s)	168
BstENI	CCTNNNNNAGG	1 cut(s)	233
BstMWI	GCNNNNNNNGC	3 cut(s)	173, 230, 326
BstNI	CCWGG	3 cut(s)	99, 120, 230
BstNSI	RCATGY	1 cut(s)	127
BstSCI	CCNGG	4 cut(s)	97, 118, 228, 388
BstSFI	CTRYAG	1 cut(s)	156
BstV1I	GCAGC	1 cut(s)	332
BstXI	CCANNNNNNTGG	1 cut(s)	341
BsuRI	GGCC	5 cut(s)	97, 137, 190, 228, 333
BtgI	CCRYGG	1 cut(s)	168
Cac8I	GCNNGC	3 cut(s)	226, 285, 331
Cfr13I	GGNCC	3 cut(s)	136, 331, 392
Csp6I	GTAC	2 cut(s)	30, 127
CviAII	CATG	3 cut(s)	16, 124, 169
CviQI	GTAC	2 cut(s)	30, 127
DdeI	CTNAG	1 cut(s)	234
EaeI	YGGCCR	1 cut(s)	188
Eam1104I	CTCTTC	2 cut(s)	89, 146
EarI	CTCTTC	2 cut(s)	89, 146
Eco130I	CCWWGG	2 cut(s)	168, 357
Eco147I	AGGCCT	1 cut(s)	228
Eco47I	GGWCC	1 cut(s)	392
EcoNI	CCTNNNNNAGG	1 cut(s)	233
EcoO109I	RGGNCCY	1 cut(s)	392
EcoRII	CCWGG	3 cut(s)	97, 118, 228
EcoT14I	CCWWGG	2 cut(s)	168, 357
ErhI	CCWWGG	2 cut(s)	168, 357
FaeI	CATG	3 cut(s)	19, 127, 172
FaqI	GGGAC	1 cut(s)	405
FatI	CATG	3 cut(s)	15, 123, 168
FauI	CCCGC	1 cut(s)	322
Fnu4HI	GCNGC	1 cut(s)	321
Fsp4HI	GCNGC	1 cut(s)	321
FspBI	CTAG	1 cut(s)	363
GluI	GCNGC	1 cut(s)	321
GsaI	CCCAGC	1 cut(s)	207
HaeIII	GGCC	5 cut(s)	97, 137, 190, 228, 333
HapII	CCGG	1 cut(s)	389
Hin1II	CATG	3 cut(s)	19, 127, 172
HindIII	AAGCTT	1 cut(s)	174
HinfI	GANTC	1 cut(s)	309
HpaII	CCGG	1 cut(s)	389
Hpy188I	TCNGA	1 cut(s)	410
HpyAV	CCTTC	1 cut(s)	411
HpyCH4III	ACNGT	2 cut(s)	29, 340
HpyCH4IV	ACGT	1 cut(s)	72
HpyCH4V	TGCA	1 cut(s)	46
HpyF10VI	GCNNNNNNNGC	3 cut(s)	173, 230, 326
HpyF3I	CTNAG	1 cut(s)	234
HpySE526I	ACGT	1 cut(s)	72
Hsp92II	CATG	3 cut(s)	19, 127, 172
KflI	GGGWCCC	1 cut(s)	392
Lsp1109I	GCAGC	1 cut(s)	332
LweI	GCATC	1 cut(s)	270
MaeI	CTAG	1 cut(s)	363
MaeII	ACGT	1 cut(s)	72
MaeIII	GTNAC	2 cut(s)	73, 269
MboII	GAAGA	3 cut(s)	76, 133, 304
MhlI	GDGCHC	1 cut(s)	370
MnlI	CCTC	3 cut(s)	92, 149, 396
MslI	CAYNNNNRTG	1 cut(s)	20
MspA1I	CMGCKG	1 cut(s)	323
MspI	CCGG	1 cut(s)	389
MspR9I	CCNGG	4 cut(s)	99, 120, 230, 390
MvaI	CCWGG	3 cut(s)	99, 120, 230
MwoI	GCNNNNNNNGC	3 cut(s)	173, 230, 326
NciI	CCSGG	1 cut(s)	390
NcoI	CCATGG	1 cut(s)	168
NlaIII	CATG	3 cut(s)	19, 127, 172
NlaIV	GGNNCC	2 cut(s)	393, 394
NmuCI	GTSAC	1 cut(s)	73
NspI	RCATGY	1 cut(s)	127
PceI	AGGCCT	1 cut(s)	228
PfeI	GAWTC	1 cut(s)	309
PfoI	TCCNGGA	1 cut(s)	388
PkrI	GCNGC	1 cut(s)	322
PpuMI	RGGWCCY	1 cut(s)	392
Psp5II	RGGWCCY	1 cut(s)	392
Psp6I	CCWGG	3 cut(s)	97, 118, 228
PspFI	CCCAGC	1 cut(s)	203
PspGI	CCWGG	3 cut(s)	97, 118, 228
PspN4I	GGNNCC	2 cut(s)	393, 394
PspPI	GGNCC	3 cut(s)	136, 331, 392
PspPPI	RGGWCCY	1 cut(s)	392
PvuII	CAGCTG	1 cut(s)	323
RsaI	GTAC	2 cut(s)	31, 128
RsaNI	GTAC	2 cut(s)	30, 127
RseI	CAYNNNNRTG	1 cut(s)	20
SatI	GCNGC	1 cut(s)	321
Sau96I	GGNCC	3 cut(s)	136, 331, 392
ScrFI	CCNGG	4 cut(s)	99, 120, 230, 390
SduI	GDGCHC	1 cut(s)	370
SetI	ASST	5 cut(s)	75, 178, 266, 325, 403
SfaNI	GCATC	1 cut(s)	270
SfcI	CTRYAG	1 cut(s)	156
SinI	GGWCC	1 cut(s)	392
SmiMI	CAYNNNNRTG	1 cut(s)	20
SseBI	AGGCCT	1 cut(s)	228
SsiI	CCGC	1 cut(s)	329
SspMI	CTAG	1 cut(s)	363
StuI	AGGCCT	1 cut(s)	228
StyD4I	CCNGG	4 cut(s)	97, 118, 228, 388
StyI	CCWWGG	2 cut(s)	168, 357
TaaI	ACNGT	2 cut(s)	29, 340
TaiI	ACGT	1 cut(s)	75
TatI	WGTACW	1 cut(s)	126
TfiI	GAWTC	1 cut(s)	309
TseFI	GTSAC	1 cut(s)	73
TseI	GCWGC	1 cut(s)	320
Tsp45I	GTSAC	1 cut(s)	73
TspDTI	ATGAA	4 cut(s)	26, 38, 304, 393
TspGWI	ACGGA	1 cut(s)	172
VpaK11BI	GGWCC	1 cut(s)	392
XagI	CCTNNNNNAGG	1 cut(s)	233
XceI	RCATGY	1 cut(s)	127
XspI	CTAG	1 cut(s)	363

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.