Rmu_sc0003984.1_g000003

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003984.1
OG0019379
Physical Location & Seq
Forward (+)
4884 .. 10120
5237 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003984.1_g000003.1.cds

Sequence Viewer

Length: 807 bp
atgccaacaactattgatgatatccctgacttggtattggttgagatcctttgtcgacttccttgtaaattcctttttcaatgcaaatgtgtgtccaaaagctggtgtactctcatacaagatccttatcttagtggccggtttatgcgtctccaaagtgatcgacggacaccagtcgtgagtactgtaattaacaccagaggagaagaatgccttactacattgtggccgtcgacctgcaagccactaacacggttgttcaaaaaactaatgcgtttctaccatttgatcgaaaagccaaacgtgccagctacatacaatgacctggttttgtgctgctcccttgagtgctgttatcaaggggattactacatctgcaatccatacacaatgcaatgggctcgtctacctccccctccaagattcttccaatttgtagctacgggatttatctgtgatcttccccactataaccataagaaagaggacgacccgaaaggaaatatcatccagctcaatgctgagtatagatacaaggttgtgagaataatttcgactgatatgtcagccagtaaatttgaagttcagatgttctcttccgagactgtgatggcgttgacggtcaacatccagcgtggtctgctccaaaataagctcccacggaatctccgccacccaccacgtgtctcgttccgattggacctacctccactcctctcctcgtttaaagcccccaccccgattcccattttccattttacgagcctagatcttcttctccttcgtcgtcgaccgagacaggtttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
F-box F-box-like

Protein Analysis

268

Amino Acids

31.26

Weight (kDa)

9.25

Isoelectric Point (pI)

51.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019379)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0163051
rosa_multiflora Rmu_sc0003984.1_g000003 Rmu_sc0025720.1_g000001
rosa_roxburghii Rroxscaffold_2G00087590
rosa_samantha Rh2BG578700 Rh2CG548600 Rh2CG548700
rosa_wichuraiana Rw2G046880

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 562
Acc36I ACCTGC 1 cut(s) 245
AccB7I CCANNNNNTGG 1 cut(s) 102
AccI GTMKAC 4 cut(s) 55, 233, 406, 790
AciI CCGC 1 cut(s) 670
AclWI GGATC 2 cut(s) 40, 116
AcoI YGGCCR 2 cut(s) 136, 227
AcsI RAATTY 2 cut(s) 68, 575
AcvI CACGTG 1 cut(s) 683
AdeI CACNNNGTG 1 cut(s) 683
AfaI GTAC 2 cut(s) 109, 184
AfiI CCNNNNNNNGG 2 cut(s) 31, 102
AflIII ACRYGT 1 cut(s) 682
AgsI TTSAA 3 cut(s) 80, 262, 581
AjnI CCWGG 1 cut(s) 324
AluBI AGCT 5 cut(s) 102, 311, 440, 514, 655
AluI AGCT 5 cut(s) 102, 311, 440, 514, 655
Alw26I GTCTC 4 cut(s) 155, 596, 691, 790
AlwI GGATC 2 cut(s) 40, 116
AoxI GGCC 2 cut(s) 136, 227
ApeKI GCWGC 1 cut(s) 336
ApoI RAATTY 2 cut(s) 68, 575
Asp700I GAANNNNTTC 1 cut(s) 550
AspS9I GGNCC 1 cut(s) 700
AvaII GGWCC 1 cut(s) 700
BanII GRGCYC 1 cut(s) 403
BbrPI CACGTG 1 cut(s) 683
BbvI GCAGC 1 cut(s) 323
BccI CCATC 1 cut(s) 604
BceAI ACGGC 1 cut(s) 214
BcgI CGANNNNNNTGC 2 cut(s) 383, 417
BciT130I CCWGG 1 cut(s) 326
BcoDI GTCTC 4 cut(s) 155, 596, 691, 790
BfaI CTAG 1 cut(s) 767
BfuAI ACCTGC 1 cut(s) 245
BglII AGATCT 1 cut(s) 769
BisI GCNGC 1 cut(s) 337
BlsI GCNGC 1 cut(s) 338
BmcAI AGTACT 1 cut(s) 184
Bme1390I CCNGG 1 cut(s) 326
Bme18I GGWCC 1 cut(s) 700
BmgT120I GGNCC 1 cut(s) 700
BmrFI CCNGG 1 cut(s) 326
BoxI GACNNNNGTC 1 cut(s) 173
BpuEI CTTGAG 1 cut(s) 365
BsaAI YACGTR 1 cut(s) 683
BsaBI GATNNNNATC 1 cut(s) 126
BsaJI CCNNGG 1 cut(s) 659
BsaXI ACNNNNNCTCC 4 cut(s) 651, 681, 696, 726
Bsc4I CCNNNNNNNGG 2 cut(s) 31, 102
Bse118I RCCGGY 1 cut(s) 138
Bse1I ACTGG 2 cut(s) 173, 570
Bse3DI GCAATG 1 cut(s) 401
Bse8I GATNNNNATC 1 cut(s) 126
BseBI CCWGG 1 cut(s) 326
BseDI CCNNGG 1 cut(s) 659
BseGI GGATG 2 cut(s) 507, 627
BseJI GATNNNNATC 1 cut(s) 126
BseLI CCNNNNNNNGG 2 cut(s) 31, 102
BseMI GCAATG 1 cut(s) 401
BseMII CTCAG 1 cut(s) 513
BseNI ACTGG 2 cut(s) 173, 570
BseRI GAGGAG 3 cut(s) 216, 704, 709
BseXI GCAGC 1 cut(s) 323
Bsh1285I CGRYCG 1 cut(s) 794
BshFI GGCC 2 cut(s) 138, 229
BsiEI CGRYCG 1 cut(s) 794
BsiSI CCGG 1 cut(s) 139
BslI CCNNNNNNNGG 2 cut(s) 31, 102
BsmAI GTCTC 4 cut(s) 155, 596, 691, 790
BsmBI CGTCTC 1 cut(s) 155
BsmI GAATGC 1 cut(s) 215
BsnI GGCC 2 cut(s) 138, 229
Bsp1286I GDGCHC 1 cut(s) 403
Bsp143I GATC 6 cut(s) 45, 121, 160, 288, 457, 769
BspACI CCGC 1 cut(s) 670
BspANI GGCC 2 cut(s) 138, 229
BspCNI CTCAG 1 cut(s) 514
BspMI ACCTGC 1 cut(s) 245
BspPI GGATC 2 cut(s) 40, 116
BsrDI GCAATG 1 cut(s) 401
BsrFI RCCGGY 1 cut(s) 138
BsrI ACTGG 2 cut(s) 173, 570
BssAI RCCGGY 1 cut(s) 138
BssECI CCNNGG 1 cut(s) 659
BssMI GATC 6 cut(s) 45, 121, 160, 288, 457, 769
Bst2UI CCWGG 1 cut(s) 326
Bst4CI ACNGT 4 cut(s) 187, 255, 607, 622
Bst6I CTCTTC 1 cut(s) 601
BstBAI YACGTR 1 cut(s) 683
BstC8I GCNNGC 2 cut(s) 242, 309
BstDEI CTNAG 2 cut(s) 131, 522
BstDSI CCRYGG 1 cut(s) 659
BstF5I GGATG 2 cut(s) 507, 627
BstKTI GATC 6 cut(s) 48, 124, 163, 291, 460, 772
BstMAI GTCTC 4 cut(s) 155, 596, 691, 790
BstMBI GATC 6 cut(s) 45, 121, 160, 288, 457, 769
BstMCI CGRYCG 1 cut(s) 794
BstMWI GCNNNNNNNGC 2 cut(s) 304, 640
BstNI CCWGG 1 cut(s) 326
BstPAI GACNNNNGTC 1 cut(s) 173
BstSCI CCNGG 1 cut(s) 324
BstV1I GCAGC 1 cut(s) 323
BstX2I RGATCY 3 cut(s) 45, 121, 769
BstYI RGATCY 3 cut(s) 45, 121, 769
BsuRI GGCC 2 cut(s) 138, 229
BtgI CCRYGG 1 cut(s) 659
BtsCI GGATG 2 cut(s) 507, 627
BveI ACCTGC 1 cut(s) 245
Cac8I GCNNGC 2 cut(s) 242, 309
Cfr10I RCCGGY 1 cut(s) 138
Cfr13I GGNCC 1 cut(s) 700
CseI GACGC 1 cut(s) 137
CsiI ACCWGGT 1 cut(s) 324
Csp6I GTAC 2 cut(s) 108, 183
CviQI GTAC 2 cut(s) 108, 183
DdeI CTNAG 2 cut(s) 131, 522
DpnI GATC 6 cut(s) 47, 123, 162, 290, 459, 771
DpnII GATC 6 cut(s) 45, 121, 160, 288, 457, 769
DraI TTTAAA 1 cut(s) 727
DraIII CACNNNGTG 1 cut(s) 683
DrdI GACNNNNNNGTC 1 cut(s) 562
DseDI GACNNNNNNGTC 1 cut(s) 562
EaeI YGGCCR 2 cut(s) 136, 227
Eam1104I CTCTTC 1 cut(s) 601
EarI CTCTTC 1 cut(s) 601
EciI GGCGGA 1 cut(s) 659
Eco24I GRGCYC 1 cut(s) 403
Eco32I GATATC 1 cut(s) 22
Eco47I GGWCC 1 cut(s) 700
Eco72I CACGTG 1 cut(s) 683
EcoRII CCWGG 1 cut(s) 324
EcoRV GATATC 1 cut(s) 22
EcoT38I GRGCYC 1 cut(s) 403
Esp3I CGTCTC 1 cut(s) 155
FaiI YATR 8 cut(s) 116, 146, 316, 385, 471, 477, 528, 563
FalI AAGNNNNNCTT 2 cut(s) 198, 230
FblI GTMKAC 4 cut(s) 55, 233, 406, 790
Fnu4HI GCNGC 1 cut(s) 337
FokI GGATG 2 cut(s) 494, 614
FriOI GRGCYC 1 cut(s) 403
Fsp4HI GCNGC 1 cut(s) 337
FspBI CTAG 1 cut(s) 767
GluI GCNGC 1 cut(s) 337
HaeIII GGCC 2 cut(s) 138, 229
HapII CCGG 1 cut(s) 139
HgaI GACGC 1 cut(s) 137
HincII GTYRAC 5 cut(s) 56, 234, 618, 625, 791
HindII GTYRAC 5 cut(s) 56, 234, 618, 625, 791
HinfI GANTC 3 cut(s) 423, 664, 742
HpaII CCGG 1 cut(s) 139
Hpy166II GTNNAC 7 cut(s) 56, 108, 234, 407, 618, 625, 791
Hpy188I TCNGA 3 cut(s) 588, 601, 695
Hpy188III TCNNGA 1 cut(s) 178
Hpy8I GTNNAC 7 cut(s) 56, 108, 234, 407, 618, 625, 791
Hpy99I CGWCG 4 cut(s) 168, 235, 789, 792
HpyAV CCTTC 1 cut(s) 791
HpyCH4III ACNGT 4 cut(s) 187, 255, 607, 622
HpyCH4IV ACGT 2 cut(s) 303, 682
HpyCH4V TGCA 4 cut(s) 84, 240, 378, 394
HpyF10VI GCNNNNNNNGC 2 cut(s) 304, 640
HpyF3I CTNAG 2 cut(s) 131, 522
HpySE526I ACGT 2 cut(s) 303, 682
Kzo9I GATC 6 cut(s) 45, 121, 160, 288, 457, 769
LmnI GCTCC 3 cut(s) 344, 648, 660
Lsp1109I GCAGC 1 cut(s) 323
MabI ACCWGGT 1 cut(s) 324
MaeI CTAG 1 cut(s) 767
MaeII ACGT 2 cut(s) 303, 682
MalI GATC 6 cut(s) 47, 123, 162, 290, 459, 771
MboI GATC 6 cut(s) 45, 121, 160, 288, 457, 769
MboII GAAGA 6 cut(s) 218, 418, 452, 588, 764, 767
MflI RGATCY 3 cut(s) 45, 121, 769
MhlI GDGCHC 1 cut(s) 403
MluCI AATT 5 cut(s) 68, 189, 431, 549, 575
MnlI CCTC 7 cut(s) 194, 420, 426, 478, 717, 725, 730
MroXI GAANNNNTTC 1 cut(s) 550
MseI TTAA 2 cut(s) 192, 726
MspI CCGG 1 cut(s) 139
MspR9I CCNGG 1 cut(s) 326
Mva1269I GAATGC 1 cut(s) 215
MvaI CCWGG 1 cut(s) 326
MwoI GCNNNNNNNGC 2 cut(s) 304, 640
NdeII GATC 6 cut(s) 45, 121, 160, 288, 457, 769
PctI GAATGC 1 cut(s) 215
PdmI GAANNNNTTC 1 cut(s) 550
PfeI GAWTC 3 cut(s) 423, 664, 742
PflMI CCANNNNNTGG 1 cut(s) 102
PkrI GCNGC 1 cut(s) 338
PmaCI CACGTG 1 cut(s) 683
PmlI CACGTG 1 cut(s) 683
Ppu21I YACGTR 1 cut(s) 683
PshAI GACNNNNGTC 1 cut(s) 173
Psp6I CCWGG 1 cut(s) 324
PspCI CACGTG 1 cut(s) 683
PspGI CCWGG 1 cut(s) 324
PspPI GGNCC 1 cut(s) 700
PsuI RGATCY 3 cut(s) 45, 121, 769
RsaI GTAC 2 cut(s) 109, 184
RsaNI GTAC 2 cut(s) 108, 183
SalI GTCGAC 3 cut(s) 54, 232, 789
SaqAI TTAA 2 cut(s) 192, 726
SatI GCNGC 1 cut(s) 337
Sau3AI GATC 6 cut(s) 45, 121, 160, 288, 457, 769
Sau96I GGNCC 1 cut(s) 700
ScaI AGTACT 1 cut(s) 184
ScrFI CCNGG 1 cut(s) 326
SduI GDGCHC 1 cut(s) 403
SexAI ACCWGGT 1 cut(s) 324
SinI GGWCC 1 cut(s) 700
SmlI CTYRAG 1 cut(s) 344
SmoI CTYRAG 1 cut(s) 344
Sse9I AATT 5 cut(s) 68, 189, 431, 549, 575
SsiI CCGC 1 cut(s) 670
SspMI CTAG 1 cut(s) 767
StyD4I CCNGG 1 cut(s) 324
TaaI ACNGT 4 cut(s) 187, 255, 607, 622
TaiI ACGT 2 cut(s) 306, 685
TaqI TCGA 6 cut(s) 55, 163, 233, 291, 554, 790
TasI AATT 5 cut(s) 68, 189, 431, 549, 575
TatI WGTACW 2 cut(s) 107, 182
TfiI GAWTC 3 cut(s) 423, 664, 742
Tru1I TTAA 2 cut(s) 192, 726
Tru9I TTAA 2 cut(s) 192, 726
TseI GCWGC 1 cut(s) 336
TspGWI ACGGA 2 cut(s) 181, 676
Van91I CCANNNNNTGG 1 cut(s) 102
VpaK11BI GGWCC 1 cut(s) 700
XapI RAATTY 2 cut(s) 68, 575
XmiI GTMKAC 4 cut(s) 55, 233, 406, 790
XmnI GAANNNNTTC 1 cut(s) 550
XspI CTAG 1 cut(s) 767
ZrmI AGTACT 1 cut(s) 184
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.