Rh2CG548700

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Forward (+)
72893612 .. 72894492
881 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG548700.1

Sequence Viewer

Length: 198 bp
ATGGCGTTGACGGTCAACATCCAGCGTGGTCTGCTCCAAAATAAGCTCCCACGGAATCTCCGCCACCCACCACGTGTCTCGTTCCGATTGGACCTACCTCCACTCCTCTCCTCGTTTAAAGCCCCCACCCCGATTCCCATTTTCCATTTTACGAGCCTAGATCTTCTTCTCCTTCGTCGTCGACCGAGACAGGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

65

Amino Acids

7.58

Weight (kDa)

12.0

Isoelectric Point (pI)

67.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019379)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0163051
rosa_multiflora Rmu_sc0003984.1_g000003 Rmu_sc0025720.1_g000001
rosa_roxburghii Rroxscaffold_2G00087590
rosa_samantha Rh2BG578700 Rh2CG548600 Rh2CG548700
rosa_wichuraiana Rw2G046880

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 181
AciI CCGC 1 cut(s) 61
AcvI CACGTG 1 cut(s) 74
AdeI CACNNNGTG 1 cut(s) 74
AflIII ACRYGT 1 cut(s) 73
AluBI AGCT 1 cut(s) 46
AluI AGCT 1 cut(s) 46
Alw26I GTCTC 2 cut(s) 82, 181
AspS9I GGNCC 1 cut(s) 91
AvaII GGWCC 1 cut(s) 91
BbrPI CACGTG 1 cut(s) 74
BcoDI GTCTC 2 cut(s) 82, 181
BfaI CTAG 1 cut(s) 158
BglII AGATCT 1 cut(s) 160
Bme18I GGWCC 1 cut(s) 91
BmgT120I GGNCC 1 cut(s) 91
BsaAI YACGTR 1 cut(s) 74
BsaJI CCNNGG 1 cut(s) 50
BsaXI ACNNNNNCTCC 4 cut(s) 42, 72, 87, 117
BseDI CCNNGG 1 cut(s) 50
BseGI GGATG 1 cut(s) 18
BseRI GAGGAG 2 cut(s) 95, 100
Bsh1285I CGRYCG 1 cut(s) 185
BsiEI CGRYCG 1 cut(s) 185
BsmAI GTCTC 2 cut(s) 82, 181
Bsp143I GATC 1 cut(s) 160
BspACI CCGC 1 cut(s) 61
BssECI CCNNGG 1 cut(s) 50
BssMI GATC 1 cut(s) 160
Bst4CI ACNGT 1 cut(s) 13
BstBAI YACGTR 1 cut(s) 74
BstDSI CCRYGG 1 cut(s) 50
BstF5I GGATG 1 cut(s) 18
BstKTI GATC 1 cut(s) 163
BstMAI GTCTC 2 cut(s) 82, 181
BstMBI GATC 1 cut(s) 160
BstMCI CGRYCG 1 cut(s) 185
BstMWI GCNNNNNNNGC 1 cut(s) 31
BstX2I RGATCY 1 cut(s) 160
BstYI RGATCY 1 cut(s) 160
BtgI CCRYGG 1 cut(s) 50
BtsCI GGATG 1 cut(s) 18
Cfr13I GGNCC 1 cut(s) 91
CviJI RGCY 3 cut(s) 46, 122, 156
CviKI_1 RGCY 3 cut(s) 46, 122, 156
DpnI GATC 1 cut(s) 162
DpnII GATC 1 cut(s) 160
DraI TTTAAA 1 cut(s) 118
DraIII CACNNNGTG 1 cut(s) 74
EciI GGCGGA 1 cut(s) 50
Eco47I GGWCC 1 cut(s) 91
Eco72I CACGTG 1 cut(s) 74
FblI GTMKAC 1 cut(s) 181
FokI GGATG 1 cut(s) 5
FspBI CTAG 1 cut(s) 158
HincII GTYRAC 3 cut(s) 9, 16, 182
HindII GTYRAC 3 cut(s) 9, 16, 182
HinfI GANTC 2 cut(s) 55, 133
Hpy166II GTNNAC 3 cut(s) 9, 16, 182
Hpy188I TCNGA 1 cut(s) 86
Hpy8I GTNNAC 3 cut(s) 9, 16, 182
Hpy99I CGWCG 2 cut(s) 180, 183
HpyAV CCTTC 1 cut(s) 182
HpyCH4III ACNGT 1 cut(s) 13
HpyCH4IV ACGT 1 cut(s) 73
HpyF10VI GCNNNNNNNGC 1 cut(s) 31
HpySE526I ACGT 1 cut(s) 73
Kzo9I GATC 1 cut(s) 160
LmnI GCTCC 2 cut(s) 39, 51
LpnPI CCDG 2 cut(s) 35, 176
MaeI CTAG 1 cut(s) 158
MaeII ACGT 1 cut(s) 73
MalI GATC 1 cut(s) 162
MboI GATC 1 cut(s) 160
MboII GAAGA 2 cut(s) 155, 158
MflI RGATCY 1 cut(s) 160
MnlI CCTC 3 cut(s) 108, 116, 121
MseI TTAA 1 cut(s) 117
MwoI GCNNNNNNNGC 1 cut(s) 31
NdeII GATC 1 cut(s) 160
PfeI GAWTC 2 cut(s) 55, 133
PmaCI CACGTG 1 cut(s) 74
PmlI CACGTG 1 cut(s) 74
Ppu21I YACGTR 1 cut(s) 74
PspCI CACGTG 1 cut(s) 74
PspPI GGNCC 1 cut(s) 91
PsuI RGATCY 1 cut(s) 160
SalI GTCGAC 1 cut(s) 180
SaqAI TTAA 1 cut(s) 117
Sau3AI GATC 1 cut(s) 160
Sau96I GGNCC 1 cut(s) 91
SetI ASST 5 cut(s) 48, 76, 96, 100, 195
SinI GGWCC 1 cut(s) 91
SsiI CCGC 1 cut(s) 61
SspMI CTAG 1 cut(s) 158
TaaI ACNGT 1 cut(s) 13
TaiI ACGT 1 cut(s) 76
TaqI TCGA 1 cut(s) 181
TfiI GAWTC 2 cut(s) 55, 133
Tru1I TTAA 1 cut(s) 117
Tru9I TTAA 1 cut(s) 117
TspGWI ACGGA 1 cut(s) 67
VpaK11BI GGWCC 1 cut(s) 91
XmiI GTMKAC 1 cut(s) 181
XspI CTAG 1 cut(s) 158
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.