Rmu_sc0004033.1_g000010

Belongs to the GRAS family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004033.1
OG0017624
Physical Location & Seq
Forward (+)
28159 .. 29778
1620 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004033.1_g000010.1.cds

Sequence Viewer

Length: 1620 bp
atggaagacttcaatgcttggctctccttcccaatccatgggagtctcaaccatgatctcgctattagaaggttctgtccagcaagacttgagcaagaacaaggaggaggagagtgggaggagatactgaatgagattcaattttgttcaccttctgaagattcaaccagcactccttgcttgcctgcttctgaagttgatgagtttgttgacagcttcatcaacatggatcactgcaaggatatcgacgacgattatcagtccctggagaaacaacaaagtagttttgattacttccaagatgggatccagacattttcaatggtggatgatctatatggagatgtcatgatgatgatggaaggagatgatcagatggagatgtgtggctcagttgaggattttggagttgtagatgatcaaactactatggtgcctagtgttgaagaggtgagccatggtgtggaccaagggcttcacttggtgcacatgttactggcttgtgctgaagctgtggggtgcagagatacaaggcttgcagattcattgctcacccaaatctgggcttcggttagtccattcggtgattccttgcagagagtctcatactgctttgcaatggggttgaagtctaggctctctcttcttcacaatgtgaacctaaatggtacattcaacaatgatactatggatgtgtcgctgatcgctagggaggagaaattggaggcttttcaactccttcaccagacgactccttacatagctttcggtttcatggttgcgaatgaagctatttgtcaagcagcacaagggaaggagagcttgcacatcattgatttgggaatggagcacactcttcaatggccatccttgttaagaaccctggcatcaagaaccgaaggcccacctaagaagctccgtatcaccggtctagttgaagatcacaatgtcttagagcttgacgctggcatgagagtcctggtggaagaggctcgttcacttggcataccaatagaattcaacatgatctcagagccggtaaaaccatcacttctgactaaagagaatctagacttgagagaaggggaagcattatgtgtcaatagcataatgcacctgcatatgtatgtcaaagagagcagaggatctttgaaggcaatcctccaagccttcaagaagttgggtccaagtgtgcttacattggtagagcaggatgcaaatcacaacgggccgttttttcttgggagatttctcgagtctcttcacttttattctgcaatttttgactctctcgaggtgagccttccacgaaacagccctcagaggatgaaaatagagagacttcactttgcagatgaaattcggaacattgttgcgtttgagggattaaatagggttgagaggcatgaaagggcagaccaatggagaaggcagttaggcagagctgggtttcaagttatgggattgaagtgtacaagtcaggctaggatgatgctatctgtttatggctgtgatgggtacagtttggctagtgagaagggttgtctcctccttgggtggaaaggaaggcctataatgttggcatctgcatggcaagtgaacaatgcctctaactcttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
GRAS

Protein Analysis

539

Amino Acids

60.58

Weight (kDa)

4.85

Isoelectric Point (pI)

43.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017624)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g14680
malus_domestica MD05G1229500.v1.1
prunus_persica Prupe.4G132100_v2.0.a1
pyrus_communis pycom05g21040
rosa_chinensis RchiOBHm_Chr5g0024171
rosa_laevigata RLG00000032776
rosa_multiflora Rmu_sc0004033.1_g000010
rosa_rugosa Rorug05G0082200
rosa_samantha Rh5BG169400 Rh5CG185300 Rh5DG171700
rosa_wichuraiana Rw5G015590

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 1125
Acc36I ACCTGC 1 cut(s) 1125
AccB1I GGYRCC 1 cut(s) 433
AccB7I CCANNNNNTGG 2 cut(s) 38, 463
AclWI GGATC 4 cut(s) 237, 301, 314, 1153
AcoI YGGCCR 1 cut(s) 863
AcsI RAATTY 2 cut(s) 1016, 1359
AcuI CTGAAG 3 cut(s) 177, 213, 528
AdeI CACNNNGTG 2 cut(s) 484, 655
AfaI GTAC 3 cut(s) 670, 1474, 1520
AfiI CCNNNNNNNGG 4 cut(s) 38, 463, 561, 562
AflIII ACRYGT 1 cut(s) 489
AgeI ACCGGT 1 cut(s) 926
AjnI CCWGG 3 cut(s) 264, 882, 978
AluBI AGCT 8 cut(s) 216, 512, 764, 791, 822, 916, 958, 1445
AluI AGCT 8 cut(s) 216, 512, 764, 791, 822, 916, 958, 1445
Alw21I GWGCWC 2 cut(s) 489, 852
Alw26I GTCTC 5 cut(s) 50, 607, 1263, 1333, 1550
Alw44I GTGCAC 1 cut(s) 485
AlwI GGATC 4 cut(s) 237, 301, 314, 1153
AlwNI CAGNNNCTG 1 cut(s) 265
Ama87I CYCGRG 2 cut(s) 1253, 1292
AoxI GGCC 4 cut(s) 863, 901, 1229, 1568
ApaLI GTGCAC 1 cut(s) 485
ApeKI GCWGC 1 cut(s) 803
ApoI RAATTY 2 cut(s) 1016, 1359
AsiGI ACCGGT 1 cut(s) 926
AspS9I GGNCC 4 cut(s) 466, 902, 1184, 1229
AsuHPI GGTGA 7 cut(s) 141, 463, 544, 596, 734, 916, 1309
AvaI CYCGRG 2 cut(s) 1253, 1292
AvaII GGWCC 2 cut(s) 466, 1184
BaeGI GKGCMC 1 cut(s) 489
BalI TGGCCA 1 cut(s) 865
BamHI GGATCC 1 cut(s) 306
BanI GGYRCC 1 cut(s) 433
BbsI GAAGAC 1 cut(s) 12
Bbv12I GWGCWC 2 cut(s) 489, 852
BbvI GCAGC 1 cut(s) 815
BccI CCATC 6 cut(s) 296, 352, 370, 874, 1054, 1508
BceAI ACGGC 1 cut(s) 1216
BcgI CGANNNNNNTGC 2 cut(s) 226, 260
BciT130I CCWGG 3 cut(s) 266, 884, 980
BclI TGATCA 2 cut(s) 370, 418
BcoDI GTCTC 5 cut(s) 50, 607, 1263, 1333, 1550
BfaI CTAG 7 cut(s) 438, 633, 708, 932, 1070, 1485, 1530
BfuAI ACCTGC 1 cut(s) 1125
BisI GCNGC 1 cut(s) 804
BlsI GCNGC 1 cut(s) 805
Bme1390I CCNGG 3 cut(s) 266, 884, 980
Bme18I GGWCC 2 cut(s) 466, 1184
BmeT110I CYCGRG 2 cut(s) 1253, 1292
BmgT120I GGNCC 4 cut(s) 466, 902, 1184, 1229
BmiI GGNNCC 3 cut(s) 308, 435, 1185
BmrFI CCNGG 3 cut(s) 266, 884, 980
BmsI GCATC 4 cut(s) 896, 1204, 1482, 1592
BpiI GAAGAC 1 cut(s) 12
BpmI CTGGAG 1 cut(s) 287
BpuEI CTTGAG 2 cut(s) 110, 1096
BsaBI GATNNNNATC 1 cut(s) 1218
BsaJI CCNNGG 6 cut(s) 37, 264, 457, 469, 882, 1552
BsaWI WCCGGW 1 cut(s) 926
BsaXI ACNNNNNCTCC 2 cut(s) 157, 187
Bsc4I CCNNNNNNNGG 4 cut(s) 38, 463, 561, 562
Bse118I RCCGGY 2 cut(s) 926, 1036
Bse1I ACTGG 1 cut(s) 501
Bse3DI GCAATG 2 cut(s) 545, 624
Bse8I GATNNNNATC 1 cut(s) 1218
BseBI CCWGG 3 cut(s) 266, 884, 980
BseDI CCNNGG 6 cut(s) 37, 264, 457, 469, 882, 1552
BseGI GGATG 6 cut(s) 334, 697, 866, 1219, 1332, 1494
BseJI GATNNNNATC 1 cut(s) 1218
BseLI CCNNNNNNNGG 4 cut(s) 38, 463, 561, 562
BseMI GCAATG 2 cut(s) 545, 624
BseMII CTCAG 3 cut(s) 405, 1044, 1334
BseNI ACTGG 1 cut(s) 501
BseRI GAGGAG 5 cut(s) 120, 123, 134, 728, 1538
BseSI GKGCMC 1 cut(s) 489
BseXI GCAGC 1 cut(s) 815
BseYI CCCAGC 1 cut(s) 1445
BsgI GTGCAG 1 cut(s) 541
BshFI GGCC 4 cut(s) 865, 903, 1231, 1570
BshNI GGYRCC 1 cut(s) 433
BshTI ACCGGT 1 cut(s) 926
BsiHKAI GWGCWC 2 cut(s) 489, 852
BsiHKCI CYCGRG 2 cut(s) 1253, 1292
BsiSI CCGG 2 cut(s) 927, 1037
BslFI GGGAC 1 cut(s) 247
BslI CCNNNNNNNGG 4 cut(s) 38, 463, 561, 562
BsmAI GTCTC 5 cut(s) 50, 607, 1263, 1333, 1550
BsmFI GGGAC 1 cut(s) 247
BsnI GGCC 4 cut(s) 865, 903, 1231, 1570
BsoBI CYCGRG 2 cut(s) 1253, 1292
Bsp1286I GDGCHC 2 cut(s) 489, 852
Bsp1407I TGTACA 1 cut(s) 1472
Bsp19I CCATGG 2 cut(s) 37, 457
BspANI GGCC 4 cut(s) 865, 903, 1231, 1570
BspCNI CTCAG 3 cut(s) 404, 1043, 1333
BspHI TCATGA 1 cut(s) 348
BspLI GGNNCC 3 cut(s) 308, 435, 1185
BspMI ACCTGC 1 cut(s) 1125
BspPI GGATC 4 cut(s) 237, 301, 314, 1153
BspT107I GGYRCC 1 cut(s) 433
BsrDI GCAATG 2 cut(s) 545, 624
BsrFI RCCGGY 2 cut(s) 926, 1036
BsrGI TGTACA 1 cut(s) 1472
BsrI ACTGG 1 cut(s) 501
BssAI RCCGGY 2 cut(s) 926, 1036
BssECI CCNNGG 6 cut(s) 37, 264, 457, 469, 882, 1552
BssT1I CCWWGG 4 cut(s) 37, 457, 469, 1552
Bst2UI CCWGG 3 cut(s) 266, 884, 980
Bst4CI ACNGT 1 cut(s) 1523
Bst6I CTCTTC 5 cut(s) 441, 648, 861, 981, 1266
BstAPI GCANNNNNTGC 1 cut(s) 177
BstAUI TGTACA 1 cut(s) 1472
BstC8I GCNNGC 5 cut(s) 182, 186, 537, 824, 967
BstDEI CTNAG 6 cut(s) 391, 909, 952, 1030, 1320, 1617
BstDSI CCRYGG 2 cut(s) 37, 457
BstF5I GGATG 6 cut(s) 334, 697, 866, 1219, 1332, 1494
BstMAI GTCTC 5 cut(s) 50, 607, 1263, 1333, 1550
BstMWI GCNNNNNNNGC 2 cut(s) 177, 788
BstNI CCWGG 3 cut(s) 266, 884, 980
BstNSI RCATGY 1 cut(s) 493
BstSCI CCNGG 3 cut(s) 264, 882, 978
BstSLI GKGCMC 1 cut(s) 489
BstV1I GCAGC 1 cut(s) 815
BstV2I GAAGAC 1 cut(s) 12
BstX2I RGATCY 2 cut(s) 306, 1145
BstYI RGATCY 2 cut(s) 306, 1145
BsuRI GGCC 4 cut(s) 865, 903, 1231, 1570
BtgI CCRYGG 2 cut(s) 37, 457
BtsCI GGATG 6 cut(s) 334, 697, 866, 1219, 1332, 1494
BtsI GCAGTG 1 cut(s) 232
BtsIMutI CAGTG 1 cut(s) 232
BveI ACCTGC 1 cut(s) 1125
Cac8I GCNNGC 5 cut(s) 182, 186, 537, 824, 967
CaiI CAGNNNCTG 1 cut(s) 265
CciI TCATGA 1 cut(s) 348
Cfr10I RCCGGY 2 cut(s) 926, 1036
Cfr13I GGNCC 4 cut(s) 466, 902, 1184, 1229
CseI GACGC 1 cut(s) 971
Csp6I GTAC 3 cut(s) 669, 1473, 1519
CspAI ACCGGT 1 cut(s) 926
CviQI GTAC 3 cut(s) 669, 1473, 1519
DdeI CTNAG 6 cut(s) 391, 909, 952, 1030, 1320, 1617
DraIII CACNNNGTG 2 cut(s) 484, 655
EaeI YGGCCR 1 cut(s) 863
Eam1104I CTCTTC 5 cut(s) 441, 648, 861, 981, 1266
EarI CTCTTC 5 cut(s) 441, 648, 861, 981, 1266
Eco130I CCWWGG 4 cut(s) 37, 457, 469, 1552
Eco147I AGGCCT 1 cut(s) 1570
Eco32I GATATC 1 cut(s) 244
Eco47I GGWCC 2 cut(s) 466, 1184
Eco57I CTGAAG 3 cut(s) 177, 213, 528
Eco88I CYCGRG 2 cut(s) 1253, 1292
EcoRI GAATTC 1 cut(s) 1016
EcoRII CCWGG 3 cut(s) 264, 882, 978
EcoRV GATATC 1 cut(s) 244
EcoT14I CCWWGG 4 cut(s) 37, 457, 469, 1552
ErhI CCWWGG 4 cut(s) 37, 457, 469, 1552
FalI AAGNNNNNCTT 2 cut(s) 806, 838
FaqI GGGAC 1 cut(s) 247
FauNDI CATATG 1 cut(s) 1122
FbaI TGATCA 2 cut(s) 370, 418
Fnu4HI GCNGC 1 cut(s) 804
FokI GGATG 6 cut(s) 341, 704, 853, 1226, 1339, 1501
Fsp4HI GCNGC 1 cut(s) 804
FspBI CTAG 7 cut(s) 438, 633, 708, 932, 1070, 1485, 1530
GluI GCNGC 1 cut(s) 804
GsaI CCCAGC 1 cut(s) 1449
GsuI CTGGAG 1 cut(s) 287
HaeIII GGCC 4 cut(s) 865, 903, 1231, 1570
HapII CCGG 2 cut(s) 927, 1037
HgaI GACGC 1 cut(s) 971
HincII GTYRAC 1 cut(s) 211
HindII GTYRAC 1 cut(s) 211
HpaII CCGG 2 cut(s) 927, 1037
HphI GGTGA 7 cut(s) 141, 463, 544, 596, 734, 916, 1309
Hpy166II GTNNAC 8 cut(s) 149, 211, 466, 487, 658, 998, 1473, 1600
Hpy188I TCNGA 7 cut(s) 157, 193, 375, 1033, 1056, 1323, 1365
Hpy188III TCNNGA 7 cut(s) 310, 349, 891, 1070, 1174, 1253, 1292
Hpy8I GTNNAC 8 cut(s) 149, 211, 466, 487, 658, 998, 1473, 1600
Hpy99I CGWCG 2 cut(s) 251, 254
HpyCH4III ACNGT 1 cut(s) 1523
HpyF10VI GCNNNNNNNGC 2 cut(s) 177, 788
HpyF3I CTNAG 6 cut(s) 391, 909, 952, 1030, 1320, 1617
Ksp22I TGATCA 2 cut(s) 370, 418
LmnI GCTCC 2 cut(s) 847, 921
Lsp1109I GCAGC 1 cut(s) 815
LweI GCATC 4 cut(s) 896, 1204, 1482, 1592
MaeI CTAG 7 cut(s) 438, 633, 708, 932, 1070, 1485, 1530
MaeIII GTNAC 1 cut(s) 492
MboII GAAGA 9 cut(s) 17, 170, 458, 635, 638, 848, 950, 998, 1253
MflI RGATCY 2 cut(s) 306, 1145
MhlI GDGCHC 2 cut(s) 489, 852
MlsI TGGCCA 1 cut(s) 865
MluCI AATT 5 cut(s) 140, 719, 1016, 1278, 1359
MluNI TGGCCA 1 cut(s) 865
MlyI GAGTC 6 cut(s) 52, 609, 745, 984, 1265, 1280
Mox20I TGGCCA 1 cut(s) 865
MscI TGGCCA 1 cut(s) 865
MseI TTAA 2 cut(s) 875, 1388
MslI CAYNNNNRTG 4 cut(s) 224, 353, 1125, 1588
Msp20I TGGCCA 1 cut(s) 865
MspI CCGG 2 cut(s) 927, 1037
MspR9I CCNGG 3 cut(s) 266, 884, 980
MvaI CCWGG 3 cut(s) 266, 884, 980
MwoI GCNNNNNNNGC 2 cut(s) 177, 788
NcoI CCATGG 2 cut(s) 37, 457
NdeI CATATG 1 cut(s) 1122
NlaIV GGNNCC 3 cut(s) 308, 435, 1185
NspI RCATGY 1 cut(s) 493
PaeR7I CTCGAG 2 cut(s) 1253, 1292
PagI TCATGA 1 cut(s) 348
PaqCI CACCTGC 1 cut(s) 1125
PceI AGGCCT 1 cut(s) 1570
PciI ACATGT 1 cut(s) 489
PfeI GAWTC 5 cut(s) 136, 161, 542, 587, 1066
PflMI CCANNNNNTGG 2 cut(s) 38, 463
PinAI ACCGGT 1 cut(s) 926
PkrI GCNGC 1 cut(s) 805
PleI GAGTC 6 cut(s) 51, 608, 745, 983, 1264, 1280
PpsI GAGTC 6 cut(s) 51, 608, 745, 983, 1264, 1280
PscI ACATGT 1 cut(s) 489
Psp6I CCWGG 3 cut(s) 264, 882, 978
PspFI CCCAGC 1 cut(s) 1445
PspGI CCWGG 3 cut(s) 264, 882, 978
PspN4I GGNNCC 3 cut(s) 308, 435, 1185
PspPI GGNCC 4 cut(s) 466, 902, 1184, 1229
PstNI CAGNNNCTG 1 cut(s) 265
PsuI RGATCY 2 cut(s) 306, 1145
RsaI GTAC 3 cut(s) 670, 1474, 1520
RsaNI GTAC 3 cut(s) 669, 1473, 1519
RseI CAYNNNNRTG 4 cut(s) 224, 353, 1125, 1588
SaqAI TTAA 2 cut(s) 875, 1388
SatI GCNGC 1 cut(s) 804
Sau96I GGNCC 4 cut(s) 466, 902, 1184, 1229
SchI GAGTC 6 cut(s) 52, 609, 745, 984, 1265, 1280
ScrFI CCNGG 3 cut(s) 266, 884, 980
SduI GDGCHC 2 cut(s) 489, 852
SfaNI GCATC 4 cut(s) 896, 1204, 1482, 1592
Sfr274I CTCGAG 2 cut(s) 1253, 1292
SinI GGWCC 2 cut(s) 466, 1184
SlaI CTCGAG 2 cut(s) 1253, 1292
SmiMI CAYNNNNRTG 4 cut(s) 224, 353, 1125, 1588
SmlI CTYRAG 4 cut(s) 89, 1075, 1253, 1292
SmoI CTYRAG 4 cut(s) 89, 1075, 1253, 1292
Sse9I AATT 5 cut(s) 140, 719, 1016, 1278, 1359
SseBI AGGCCT 1 cut(s) 1570
SspMI CTAG 7 cut(s) 438, 633, 708, 932, 1070, 1485, 1530
StuI AGGCCT 1 cut(s) 1570
StyD4I CCNGG 3 cut(s) 264, 882, 978
StyI CCWWGG 4 cut(s) 37, 457, 469, 1552
TaaI ACNGT 1 cut(s) 1523
TaqI TCGA 3 cut(s) 246, 1254, 1293
TasI AATT 5 cut(s) 140, 719, 1016, 1278, 1359
TatI WGTACW 1 cut(s) 1472
TfiI GAWTC 5 cut(s) 136, 161, 542, 587, 1066
Tru1I TTAA 2 cut(s) 875, 1388
Tru9I TTAA 2 cut(s) 875, 1388
TscAI CASTG 1 cut(s) 239
TseI GCWGC 1 cut(s) 803
TspDTI ATGAA 7 cut(s) 208, 534, 763, 801, 1343, 1371, 1422
TspGWI ACGGA 1 cut(s) 908
TspRI CASTG 1 cut(s) 239
Van91I CCANNNNNTGG 2 cut(s) 38, 463
VneI GTGCAC 1 cut(s) 485
VpaK11BI GGWCC 2 cut(s) 466, 1184
XapI RAATTY 2 cut(s) 1016, 1359
XbaI TCTAGA 1 cut(s) 1069
XceI RCATGY 1 cut(s) 493
XhoI CTCGAG 2 cut(s) 1253, 1292
XspI CTAG 7 cut(s) 438, 633, 708, 932, 1070, 1485, 1530
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.