Rmu_sc0004199.1_g000024

Osmotin-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004199.1
OG0020027
Physical Location & Seq
Reverse (-)
158871 .. 159928
1058 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004199.1_g000024.1.cds

Sequence Viewer

Length: 423 bp
atggaagagagagaaactataggagacttcgccagagcctgctcaccggctccggattccggcaaactttcaccagattccggccaactttcactggatttcggcagctcccacttgaccaaccacttctcctgcctcaccggcgactgctgcagcaagctagagtgcaacggcaacggccccgacgcagcccctgcaactcttgcccggttcgtcctctaccacggccccaacgacaatggtttacggcgtcagagattgacagagagagagagagagaagttaaaaaagttgcggctgcttgaggcgtccatgaaccggctgacgggaccgattcccgacgagttgactcggctggaaggcctgaatatttatgagaacaacttgaggggagcttgctggcatgcattgcagactcgctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Thaumatin

Protein Analysis

140

Amino Acids

15.53

Weight (kDa)

6.42

Isoelectric Point (pI)

45.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020027)

Species Orthologous Gene IDs
rosa_laevigata RLG00000016946
rosa_multiflora Rmu_sc0000157.1_g000040 Rmu_sc0002819.1_g000008 Rmu_sc0004199.1_g000024 Rmu_sc0035221.1_g000001
rosa_roxburghii Rroxscaffold_2G00140740
rosa_samantha Rh5CG217800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 52
AciI CCGC 1 cut(s) 295
AcoI YGGCCR 1 cut(s) 82
AcyI GRCGYC 2 cut(s) 250, 308
AfiI CCNNNNNNNGG 4 cut(s) 59, 80, 318, 325
AluBI AGCT 3 cut(s) 108, 160, 395
AluI AGCT 3 cut(s) 108, 160, 395
Alw26I GTCTC 1 cut(s) 18
AlwNI CAGNNNCTG 2 cut(s) 39, 194
Aor13HI TCCGGA 1 cut(s) 52
AoxI GGCC 4 cut(s) 82, 178, 226, 361
ApeKI GCWGC 5 cut(s) 105, 150, 153, 188, 298
AspS9I GGNCC 3 cut(s) 179, 227, 329
AsuC2I CCSGG 1 cut(s) 208
AsuHPI GGTGA 3 cut(s) 36, 63, 130
AvaII GGWCC 1 cut(s) 329
BbvI GCAGC 5 cut(s) 117, 137, 165, 200, 285
BceAI ACGGC 4 cut(s) 187, 193, 241, 263
BcnI CCSGG 1 cut(s) 208
BcoDI GTCTC 1 cut(s) 18
BfaI CTAG 1 cut(s) 161
BfmI CTRYAG 2 cut(s) 18, 151
BglI GCCNNNNNGGC 1 cut(s) 141
BisI GCNGC 6 cut(s) 106, 151, 154, 189, 296, 299
BlsI GCNGC 6 cut(s) 107, 152, 155, 190, 297, 300
Bme1390I CCNGG 1 cut(s) 208
Bme18I GGWCC 1 cut(s) 329
BmgT120I GGNCC 3 cut(s) 179, 227, 329
BmiI GGNNCC 4 cut(s) 51, 181, 229, 330
BmrFI CCNGG 1 cut(s) 208
BpuEI CTTGAG 2 cut(s) 323, 406
BpuMI CCSGG 1 cut(s) 208
BsaHI GRCGYC 2 cut(s) 250, 308
BsaJI CCNNGG 1 cut(s) 223
BsaWI WCCGGW 1 cut(s) 52
BsaXI ACNNNNNCTCC 2 cut(s) 113, 143
Bsc4I CCNNNNNNNGG 4 cut(s) 59, 80, 318, 325
Bse118I RCCGGY 3 cut(s) 46, 140, 318
Bse1I ACTGG 1 cut(s) 99
Bse3DI GCAATG 1 cut(s) 407
BseAI TCCGGA 1 cut(s) 52
BseDI CCNNGG 1 cut(s) 223
BseLI CCNNNNNNNGG 4 cut(s) 59, 80, 318, 325
BseMI GCAATG 1 cut(s) 407
BseNI ACTGG 1 cut(s) 99
BseXI GCAGC 5 cut(s) 117, 137, 165, 200, 285
BshFI GGCC 4 cut(s) 84, 180, 228, 363
BsiSI CCGG 7 cut(s) 47, 53, 60, 81, 141, 208, 319
BslFI GGGAC 1 cut(s) 342
BslI CCNNNNNNNGG 4 cut(s) 59, 80, 318, 325
BsmAI GTCTC 1 cut(s) 18
BsmFI GGGAC 1 cut(s) 342
BsnI GGCC 4 cut(s) 84, 180, 228, 363
Bsp13I TCCGGA 1 cut(s) 52
BspACI CCGC 1 cut(s) 295
BspANI GGCC 4 cut(s) 84, 180, 228, 363
BspEI TCCGGA 1 cut(s) 52
BspLI GGNNCC 4 cut(s) 51, 181, 229, 330
BspMAI CTGCAG 1 cut(s) 155
BsrDI GCAATG 1 cut(s) 407
BsrFI RCCGGY 3 cut(s) 46, 140, 318
BsrI ACTGG 1 cut(s) 99
BssAI RCCGGY 3 cut(s) 46, 140, 318
BssECI CCNNGG 1 cut(s) 223
BssNI GRCGYC 2 cut(s) 250, 308
BstACI GRCGYC 2 cut(s) 250, 308
BstAPI GCANNNNNTGC 3 cut(s) 194, 203, 409
BstC8I GCNNGC 5 cut(s) 40, 158, 397, 401, 405
BstDSI CCRYGG 1 cut(s) 223
BstMAI GTCTC 1 cut(s) 18
BstMWI GCNNNNNNNGC 5 cut(s) 141, 150, 194, 203, 409
BstNSI RCATGY 1 cut(s) 407
BstSCI CCNGG 1 cut(s) 206
BstSFI CTRYAG 2 cut(s) 18, 151
BstV1I GCAGC 5 cut(s) 117, 137, 165, 200, 285
BsuRI GGCC 4 cut(s) 84, 180, 228, 363
BtgI CCRYGG 1 cut(s) 223
BtsIMutI CAGTG 1 cut(s) 92
Cac8I GCNNGC 5 cut(s) 40, 158, 397, 401, 405
CaiI CAGNNNCTG 2 cut(s) 39, 194
Cfr10I RCCGGY 3 cut(s) 46, 140, 318
Cfr13I GGNCC 3 cut(s) 179, 227, 329
CseI GACGC 3 cut(s) 194, 239, 297
CviAII CATG 2 cut(s) 313, 404
EaeI YGGCCR 1 cut(s) 82
Eco147I AGGCCT 1 cut(s) 363
Eco47I GGWCC 1 cut(s) 329
EcoT22I ATGCAT 1 cut(s) 409
FaeI CATG 2 cut(s) 316, 407
FaiI YATR 4 cut(s) 20, 314, 375, 405
FaqI GGGAC 1 cut(s) 342
FatI CATG 2 cut(s) 312, 403
Fnu4HI GCNGC 6 cut(s) 106, 151, 154, 189, 296, 299
Fsp4HI GCNGC 6 cut(s) 106, 151, 154, 189, 296, 299
FspBI CTAG 1 cut(s) 161
GluI GCNGC 6 cut(s) 106, 151, 154, 189, 296, 299
HaeIII GGCC 4 cut(s) 84, 180, 228, 363
HapII CCGG 7 cut(s) 47, 53, 60, 81, 141, 208, 319
HgaI GACGC 3 cut(s) 194, 239, 297
Hin1I GRCGYC 2 cut(s) 250, 308
Hin1II CATG 2 cut(s) 316, 407
HincII GTYRAC 1 cut(s) 348
HindII GTYRAC 1 cut(s) 348
HinfI GANTC 5 cut(s) 56, 77, 334, 349, 415
HpaII CCGG 7 cut(s) 47, 53, 60, 81, 141, 208, 319
HphI GGTGA 3 cut(s) 36, 63, 130
Hpy166II GTNNAC 2 cut(s) 245, 348
Hpy188I TCNGA 1 cut(s) 255
Hpy188III TCNNGA 2 cut(s) 53, 338
Hpy8I GTNNAC 2 cut(s) 245, 348
Hpy99I CGWCG 2 cut(s) 188, 344
HpyAV CCTTC 1 cut(s) 353
HpyCH4V TGCA 5 cut(s) 153, 168, 197, 407, 412
HpyF10VI GCNNNNNNNGC 5 cut(s) 141, 150, 194, 203, 409
Hsp92I GRCGYC 2 cut(s) 250, 308
Hsp92II CATG 2 cut(s) 316, 407
Kpn2I TCCGGA 1 cut(s) 52
LmnI GCTCC 3 cut(s) 55, 113, 392
Lsp1109I GCAGC 5 cut(s) 117, 137, 165, 200, 285
MaeI CTAG 1 cut(s) 161
MboII GAAGA 1 cut(s) 17
MlyI GAGTC 2 cut(s) 343, 409
MnlI CCTC 4 cut(s) 146, 227, 298, 381
Mph1103I ATGCAT 1 cut(s) 409
MroI TCCGGA 1 cut(s) 52
MseI TTAA 1 cut(s) 284
MspI CCGG 7 cut(s) 47, 53, 60, 81, 141, 208, 319
MspR9I CCNGG 1 cut(s) 208
MwoI GCNNNNNNNGC 5 cut(s) 141, 150, 194, 203, 409
NciI CCSGG 1 cut(s) 208
NlaIII CATG 2 cut(s) 316, 407
NlaIV GGNNCC 4 cut(s) 51, 181, 229, 330
NmeAIII GCCGAG 1 cut(s) 331
NsiI ATGCAT 1 cut(s) 409
NspI RCATGY 1 cut(s) 407
PaeI GCATGC 1 cut(s) 407
PceI AGGCCT 1 cut(s) 363
PcsI WCGNNNNNNNCGW 1 cut(s) 231
PfeI GAWTC 3 cut(s) 56, 77, 334
PkrI GCNGC 6 cut(s) 107, 152, 155, 190, 297, 300
PleI GAGTC 2 cut(s) 343, 409
PpsI GAGTC 2 cut(s) 343, 409
PspN4I GGNNCC 4 cut(s) 51, 181, 229, 330
PspPI GGNCC 3 cut(s) 179, 227, 329
PstI CTGCAG 1 cut(s) 155
PstNI CAGNNNCTG 2 cut(s) 39, 194
SaqAI TTAA 1 cut(s) 284
SatI GCNGC 6 cut(s) 106, 151, 154, 189, 296, 299
Sau96I GGNCC 3 cut(s) 179, 227, 329
SchI GAGTC 2 cut(s) 343, 409
ScrFI CCNGG 1 cut(s) 208
SetI ASST 3 cut(s) 110, 162, 397
SfcI CTRYAG 2 cut(s) 18, 151
SgrAI CRCCGGYG 1 cut(s) 140
SinI GGWCC 1 cut(s) 329
SmlI CTYRAG 2 cut(s) 302, 385
SmoI CTYRAG 2 cut(s) 302, 385
SphI GCATGC 1 cut(s) 407
SseBI AGGCCT 1 cut(s) 363
SsiI CCGC 1 cut(s) 295
SspI AATATT 1 cut(s) 370
SspMI CTAG 1 cut(s) 161
StuI AGGCCT 1 cut(s) 363
StyD4I CCNGG 1 cut(s) 206
TaqII GACCGA 1 cut(s) 346
TauI GCSGC 1 cut(s) 298
TfiI GAWTC 3 cut(s) 56, 77, 334
Tru1I TTAA 1 cut(s) 284
Tru9I TTAA 1 cut(s) 284
TscAI CASTG 1 cut(s) 99
TseI GCWGC 5 cut(s) 105, 150, 153, 188, 298
TspDTI ATGAA 1 cut(s) 329
TspRI CASTG 1 cut(s) 99
VpaK11BI GGWCC 1 cut(s) 329
XceI RCATGY 1 cut(s) 407
XspI CTAG 1 cut(s) 161
Zsp2I ATGCAT 1 cut(s) 409
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.