Rmu_sc0004343.1_g000015

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004343.1
Physical Location & Seq
Forward (+)
54140 .. 54499
360 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004343.1_g000015.1.cds

Sequence Viewer

Length: 360 bp
atgagttttcaagacatggttgggagaggtttgggatttcagtatgagaagctgagcaaaaggaatgagaagatgagtaggtctggaaggcatatttgggtgaagaagatgaatggaaagctaaagggttttcggctatcccgctctaggaagtttactttgaaggttttctcagtagttgtgtggccaagcaggattgcaaggatttacagtgaggttgtgaagagattgaaaactgatggagtttatcccaatattattttctctactcaatggggccttccagttctatctcattcatcagtcaaatttagggagacagtagcgaaggctccctatgctaggagctgtatcaaatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

119

Amino Acids

13.83

Weight (kDa)

11.1

Isoelectric Point (pI)

58.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015481)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 144
AciI CCGC 1 cut(s) 142
AcoI YGGCCR 1 cut(s) 185
AcsI RAATTY 1 cut(s) 308
AfiI CCNNNNNNNGG 2 cut(s) 147, 342
AgsI TTSAA 3 cut(s) 11, 163, 232
AjuI GAANNNNNNNTTGG 4 cut(s) 79, 111, 245, 277
AluBI AGCT 3 cut(s) 52, 121, 348
AluI AGCT 3 cut(s) 52, 121, 348
Alw26I GTCTC 1 cut(s) 311
AoxI GGCC 2 cut(s) 185, 277
ApoI RAATTY 1 cut(s) 308
Asp700I GAANNNNTTC 1 cut(s) 167
AspS9I GGNCC 1 cut(s) 277
AsuHPI GGTGA 1 cut(s) 112
BalI TGGCCA 1 cut(s) 187
BccI CCATC 1 cut(s) 233
BcoDI GTCTC 1 cut(s) 311
BfaI CTAG 2 cut(s) 147, 342
BlpI GCTNAGC 1 cut(s) 53
BmgT120I GGNCC 1 cut(s) 277
BmiI GGNNCC 2 cut(s) 278, 333
Bpu1102I GCTNAGC 1 cut(s) 53
Bsc4I CCNNNNNNNGG 2 cut(s) 147, 342
Bse1I ACTGG 1 cut(s) 284
BseLI CCNNNNNNNGG 2 cut(s) 147, 342
BseMII CTCAG 2 cut(s) 44, 186
BseNI ACTGG 1 cut(s) 284
BshFI GGCC 2 cut(s) 187, 279
BslI CCNNNNNNNGG 2 cut(s) 147, 342
BsmAI GTCTC 1 cut(s) 311
BsnI GGCC 2 cut(s) 187, 279
Bsp1720I GCTNAGC 1 cut(s) 53
BspACI CCGC 1 cut(s) 142
BspANI GGCC 2 cut(s) 187, 279
BspCNI CTCAG 2 cut(s) 45, 185
BspLI GGNNCC 2 cut(s) 278, 333
BsrBI CCGCTC 1 cut(s) 144
BsrI ACTGG 1 cut(s) 284
Bst4CI ACNGT 2 cut(s) 212, 322
Bst6I CTCTTC 1 cut(s) 218
BstDEI CTNAG 2 cut(s) 53, 172
BstENI CCTNNNNNAGG 1 cut(s) 340
BstMAI GTCTC 1 cut(s) 311
BstMWI GCNNNNNNNGC 1 cut(s) 338
BsuRI GGCC 2 cut(s) 187, 279
BtsIMutI CAGTG 1 cut(s) 217
Cfr13I GGNCC 1 cut(s) 277
CviAII CATG 1 cut(s) 16
CviJI RGCY 7 cut(s) 52, 121, 136, 187, 279, 332, 348
CviKI_1 RGCY 7 cut(s) 52, 121, 136, 187, 279, 332, 348
DdeI CTNAG 2 cut(s) 53, 172
EaeI YGGCCR 1 cut(s) 185
Eam1104I CTCTTC 1 cut(s) 218
EarI CTCTTC 1 cut(s) 218
EcoNI CCTNNNNNAGG 1 cut(s) 340
EcoO109I RGGNCCY 1 cut(s) 277
FaeI CATG 1 cut(s) 19
FaiI YATR 4 cut(s) 17, 45, 93, 339
FatI CATG 1 cut(s) 15
FauI CCCGC 1 cut(s) 149
FspBI CTAG 2 cut(s) 147, 342
HaeIII GGCC 2 cut(s) 187, 279
Hin1II CATG 1 cut(s) 19
HphI GGTGA 1 cut(s) 112
Hpy166II GTNNAC 1 cut(s) 156
Hpy188III TCNNGA 2 cut(s) 11, 84
Hpy8I GTNNAC 1 cut(s) 156
HpyAV CCTTC 4 cut(s) 81, 157, 290, 322
HpyCH4III ACNGT 2 cut(s) 212, 322
HpyCH4V TGCA 1 cut(s) 200
HpyF10VI GCNNNNNNNGC 1 cut(s) 338
HpyF3I CTNAG 2 cut(s) 53, 172
Hsp92II CATG 1 cut(s) 19
LmnI GCTCC 2 cut(s) 337, 345
LpnPI CCDG 3 cut(s) 69, 178, 297
MaeI CTAG 2 cut(s) 147, 342
MbiI CCGCTC 1 cut(s) 144
MboII GAAGA 4 cut(s) 82, 115, 118, 235
MlsI TGGCCA 1 cut(s) 187
MluCI AATT 1 cut(s) 308
MluNI TGGCCA 1 cut(s) 187
MnlI CCTC 2 cut(s) 20, 208
Mox20I TGGCCA 1 cut(s) 187
MroXI GAANNNNTTC 1 cut(s) 167
MscI TGGCCA 1 cut(s) 187
Msp20I TGGCCA 1 cut(s) 187
MwoI GCNNNNNNNGC 1 cut(s) 338
NlaIII CATG 1 cut(s) 19
NlaIV GGNNCC 2 cut(s) 278, 333
PdmI GAANNNNTTC 1 cut(s) 167
PspN4I GGNNCC 2 cut(s) 278, 333
PspPI GGNCC 1 cut(s) 277
Sau96I GGNCC 1 cut(s) 277
SetI ASST 7 cut(s) 31, 54, 83, 123, 168, 219, 350
Sse9I AATT 1 cut(s) 308
SsiI CCGC 1 cut(s) 142
SspI AATATT 1 cut(s) 256
SspMI CTAG 2 cut(s) 147, 342
TaaI ACNGT 2 cut(s) 212, 322
TasI AATT 1 cut(s) 308
TscAI CASTG 1 cut(s) 217
TspDTI ATGAA 2 cut(s) 125, 288
TspRI CASTG 1 cut(s) 217
XagI CCTNNNNNAGG 1 cut(s) 340
XapI RAATTY 1 cut(s) 308
XmnI GAANNNNTTC 1 cut(s) 167
XspI CTAG 2 cut(s) 147, 342
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.