Rroxscaffold_6G00420560

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
Physical Location & Seq
Forward (+)
41768543 .. 41768899
357 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00420560.1

Sequence Viewer

Length: 357 bp
ATGGGTTTTCAAGACTTGGTTGGGGGAGGTTTGAAATTTCAATATGAAAAGCTCAGCAAGAGGAATGAGAAGAATGGCAGGGCTGGAAAGCATATTTGGGTGAAGAAGATGAATGGAAGGCTAAAGGGTTTTCGGCTATCACGCTCTAGGAAGTTTACTTTAAAGGTTTTCTCAGTAGTGTGGCCAAGCAGGATTGCAAGGATTTACAGTGAGATTGTGAACAGATTGAAAACTGATGGAGTTTATCCCAATATTATTTTCTCTACTCAATGGGGGCTTCCAGTTCTATCTCATTCATCTGTTAAATTTAGGGAGACAGTAGCAAAGGCTCCCTATGCTAGTAGCTGTATCAAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

118

Amino Acids

13.52

Weight (kDa)

10.78

Isoelectric Point (pI)

40.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015481)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 182
AcsI RAATTY 2 cut(s) 35, 305
AgsI TTSAA 4 cut(s) 11, 34, 41, 229
AjuI GAANNNNNNNTTGG 4 cut(s) 79, 111, 242, 274
AluBI AGCT 2 cut(s) 52, 345
AluI AGCT 2 cut(s) 52, 345
Alw26I GTCTC 1 cut(s) 308
AoxI GGCC 1 cut(s) 182
ApoI RAATTY 2 cut(s) 35, 305
AsuHPI GGTGA 1 cut(s) 112
BalI TGGCCA 1 cut(s) 184
BccI CCATC 1 cut(s) 230
BcoDI GTCTC 1 cut(s) 308
BfaI CTAG 2 cut(s) 147, 339
BlpI GCTNAGC 1 cut(s) 53
BmiI GGNNCC 1 cut(s) 330
Bpu1102I GCTNAGC 1 cut(s) 53
Bse1I ACTGG 1 cut(s) 281
BseMII CTCAG 2 cut(s) 67, 186
BseNI ACTGG 1 cut(s) 281
BshFI GGCC 1 cut(s) 184
BsmAI GTCTC 1 cut(s) 308
BsnI GGCC 1 cut(s) 184
Bsp1720I GCTNAGC 1 cut(s) 53
BspANI GGCC 1 cut(s) 184
BspCNI CTCAG 2 cut(s) 66, 185
BspLI GGNNCC 1 cut(s) 330
BsrI ACTGG 1 cut(s) 281
Bst4CI ACNGT 2 cut(s) 209, 319
BstDEI CTNAG 2 cut(s) 53, 172
BstMAI GTCTC 1 cut(s) 308
BstMWI GCNNNNNNNGC 1 cut(s) 335
BsuRI GGCC 1 cut(s) 184
BtsIMutI CAGTG 1 cut(s) 214
CviJI RGCY 8 cut(s) 52, 83, 121, 136, 184, 277, 329, 345
CviKI_1 RGCY 8 cut(s) 52, 83, 121, 136, 184, 277, 329, 345
DdeI CTNAG 2 cut(s) 53, 172
DraI TTTAAA 1 cut(s) 162
EaeI YGGCCR 1 cut(s) 182
FaiI YATR 3 cut(s) 45, 93, 336
FspBI CTAG 2 cut(s) 147, 339
HaeIII GGCC 1 cut(s) 184
HphI GGTGA 1 cut(s) 112
Hpy166II GTNNAC 2 cut(s) 156, 220
Hpy188III TCNNGA 1 cut(s) 11
Hpy8I GTNNAC 2 cut(s) 156, 220
HpyAV CCTTC 1 cut(s) 111
HpyCH4III ACNGT 2 cut(s) 209, 319
HpyCH4V TGCA 1 cut(s) 197
HpyF10VI GCNNNNNNNGC 1 cut(s) 335
HpyF3I CTNAG 2 cut(s) 53, 172
LmnI GCTCC 1 cut(s) 334
LpnPI CCDG 4 cut(s) 64, 69, 175, 294
MaeI CTAG 2 cut(s) 147, 339
MboII GAAGA 3 cut(s) 82, 115, 118
MlsI TGGCCA 1 cut(s) 184
MluCI AATT 2 cut(s) 35, 305
MluNI TGGCCA 1 cut(s) 184
MnlI CCTC 2 cut(s) 20, 54
Mox20I TGGCCA 1 cut(s) 184
MscI TGGCCA 1 cut(s) 184
MseI TTAA 2 cut(s) 161, 303
Msp20I TGGCCA 1 cut(s) 184
MwoI GCNNNNNNNGC 1 cut(s) 335
NlaIV GGNNCC 1 cut(s) 330
PspN4I GGNNCC 1 cut(s) 330
SaqAI TTAA 2 cut(s) 161, 303
SetI ASST 4 cut(s) 31, 54, 168, 347
Sse9I AATT 2 cut(s) 35, 305
SspI AATATT 1 cut(s) 253
SspMI CTAG 2 cut(s) 147, 339
TaaI ACNGT 2 cut(s) 209, 319
TasI AATT 2 cut(s) 35, 305
Tru1I TTAA 2 cut(s) 161, 303
Tru9I TTAA 2 cut(s) 161, 303
TscAI CASTG 1 cut(s) 214
TspDTI ATGAA 3 cut(s) 60, 125, 285
TspRI CASTG 1 cut(s) 214
XapI RAATTY 2 cut(s) 35, 305
XspI CTAG 2 cut(s) 147, 339
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.