Rmu_sc0004757.1_g000009

Core-2/I-Branching enzyme

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004757.1
Physical Location & Seq
Reverse (-)
27827 .. 31090
3264 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004757.1_g000009.1.cds

Sequence Viewer

Length: 1161 bp
atgcagtcaagggtgggggcattggaggaaagcaaggaccctggtggtagtacattaaaaaccagccatgtaagggccttgcctttgaggctgatccaattcctgttgatgtttgtggttctgggtctcggggtttccattttgagtatgcatacgatccggtatttcggtgttcaacatttggctccaacagaaccatctgatgtgaggtcatgttttgtggagccaaacacgttagaaagttggattagacctccatctagtctgttgcattccatgaatgacactgagttgctgtggctggcctcatgtgttcctcaagtgaaagaatatccgttcaaaagaactcccaagattgctttcatgttcttgaccaagggaccattgccgatggagcctctttgggagcggtttttcaaagggcacgaggggctttactcgatctatgtccattcgttgccatcttatagtcccaacttctcaagttcatcagtgttttacaagagacaaattccaagcaagctcgcagagtggggagagatgaatatgtgtgaggctgagagaagacttctagctaatgcattgcttgacatctcaaatgaatggtttgtcctcctttccgagtcttgtattcctctgagcaacctcagcattgtctatcactacttatcgaaatcaaggtacagctttatgggttcatttgacgaaatcggaccttatgggagaggacgctataatgaacacatggcccctttggtcaatctcagtaattggcgtaaaggttcccagtggtttgagatcaatcggatacttgcacataagattgttcaagacacaacttactaccctattttcagagacttttgcaaacctgcatgttatgtagatgagcactactttcagacgatgcttaccatcgagactccgcatcttttggcaaataggactcttacgtatgttgactggtcaagaggtggtgctcatccggctacgttcggtaaaggtgatattacagaagagttcttcaagaagattactactagcgaaaattgtctctacaacaatcagccgaccacgctctgtttcctttttgctagaaagtttgctccaagtgctttggagcctctgttagaattagcatctaaagtctttggatattga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

386

Amino Acids

44.33

Weight (kDa)

8.04

Isoelectric Point (pI)

43.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 880
AccBSI CCGCTC 1 cut(s) 409
AciI CCGC 2 cut(s) 409, 926
AclWI GGATC 2 cut(s) 88, 151
AcsI RAATTY 1 cut(s) 510
AfaI GTAC 2 cut(s) 52, 683
AfiI CCNNNNNNNGG 1 cut(s) 73
AflIII ACRYGT 1 cut(s) 231
AgsI TTSAA 5 cut(s) 176, 340, 418, 830, 1027
AjnI CCWGG 1 cut(s) 40
AjuI GAANNNNNNNTTGG 2 cut(s) 344, 376
AluBI AGCT 3 cut(s) 523, 575, 687
AluI AGCT 3 cut(s) 523, 575, 687
Alw21I GWGCWC 2 cut(s) 894, 982
Alw26I GTCTC 5 cut(s) 131, 499, 852, 914, 1058
AlwI GGATC 2 cut(s) 88, 151
Ama87I CYCGRG 1 cut(s) 128
AoxI GGCC 3 cut(s) 75, 303, 747
ApoI RAATTY 1 cut(s) 510
AspS9I GGNCC 5 cut(s) 37, 75, 380, 713, 748
AsuHPI GGTGA 1 cut(s) 1016
AvaI CYCGRG 1 cut(s) 128
AvaII GGWCC 3 cut(s) 37, 380, 713
BaeGI GKGCMC 1 cut(s) 426
BauI CACGAG 1 cut(s) 425
BbsI GAAGAC 1 cut(s) 571
Bbv12I GWGCWC 2 cut(s) 894, 982
BbvCI CCTCAGC 1 cut(s) 647
BccI CCATC 5 cut(s) 205, 265, 385, 469, 923
BciT130I CCWGG 1 cut(s) 42
BciVI GTATCC 1 cut(s) 801
BcoDI GTCTC 5 cut(s) 131, 499, 852, 914, 1058
BfaI CTAG 4 cut(s) 261, 572, 1041, 1095
BfuAI ACCTGC 1 cut(s) 880
BfuI GTATCC 1 cut(s) 801
BglI GCCNNNNNGGC 1 cut(s) 88
Bme1390I CCNGG 1 cut(s) 42
Bme18I GGWCC 3 cut(s) 37, 380, 713
BmeT110I CYCGRG 1 cut(s) 128
BmgT120I GGNCC 5 cut(s) 37, 75, 380, 713, 748
BmiI GGNNCC 8 cut(s) 39, 186, 225, 381, 396, 750, 784, 1122
BmrFI CCNGG 1 cut(s) 42
BmrI ACTGGG 1 cut(s) 781
BmsI GCATC 3 cut(s) 897, 937, 1148
BmuI ACTGGG 1 cut(s) 781
BpiI GAAGAC 1 cut(s) 571
Bpu10I CCTNAGC 1 cut(s) 647
BpuEI CTTGAG 2 cut(s) 303, 466
BsaAI YACGTR 1 cut(s) 954
BsaI GGTCTC 1 cut(s) 131
BsaJI CCNNGG 2 cut(s) 40, 375
BsaWI WCCGGW 1 cut(s) 159
BsaXI ACNNNNNCTCC 2 cut(s) 1112, 1142
Bsc4I CCNNNNNNNGG 1 cut(s) 73
Bse1I ACTGG 2 cut(s) 787, 968
Bse3DI GCAATG 2 cut(s) 383, 581
BseBI CCWGG 1 cut(s) 42
BseDI CCNNGG 2 cut(s) 40, 375
BseGI GGATG 1 cut(s) 982
BseLI CCNNNNNNNGG 1 cut(s) 73
BseMI GCAATG 2 cut(s) 383, 581
BseMII CTCAG 5 cut(s) 279, 549, 629, 661, 778
BseNI ACTGG 2 cut(s) 787, 968
BseSI GKGCMC 1 cut(s) 426
BshFI GGCC 3 cut(s) 77, 305, 749
BsiHKAI GWGCWC 2 cut(s) 894, 982
BsiHKCI CYCGRG 1 cut(s) 128
BsiSI CCGG 2 cut(s) 160, 986
BslFI GGGAC 2 cut(s) 393, 456
BslI CCNNNNNNNGG 1 cut(s) 73
BsmAI GTCTC 5 cut(s) 131, 499, 852, 914, 1058
BsmFI GGGAC 2 cut(s) 393, 456
BsmI GAATGC 1 cut(s) 271
BsnI GGCC 3 cut(s) 77, 305, 749
Bso31I GGTCTC 1 cut(s) 131
BsoBI CYCGRG 1 cut(s) 128
Bsp1286I GDGCHC 3 cut(s) 426, 894, 982
Bsp143I GATC 4 cut(s) 93, 156, 441, 798
BspACI CCGC 2 cut(s) 409, 926
BspANI GGCC 3 cut(s) 77, 305, 749
BspCNI CTCAG 5 cut(s) 280, 550, 630, 660, 777
BspLI GGNNCC 8 cut(s) 39, 186, 225, 381, 396, 750, 784, 1122
BspMI ACCTGC 1 cut(s) 880
BspPI GGATC 2 cut(s) 88, 151
BspTNI GGTCTC 1 cut(s) 131
BsrBI CCGCTC 1 cut(s) 409
BsrDI GCAATG 2 cut(s) 383, 581
BsrI ACTGG 2 cut(s) 787, 968
BssECI CCNNGG 2 cut(s) 40, 375
BssMI GATC 4 cut(s) 93, 156, 441, 798
BssSI CACGAG 1 cut(s) 425
BssT1I CCWWGG 1 cut(s) 375
Bst2BI CACGAG 1 cut(s) 425
Bst2UI CCWGG 1 cut(s) 42
Bst6I CTCTTC 1 cut(s) 1011
BstBAI YACGTR 1 cut(s) 954
BstC8I GCNNGC 3 cut(s) 303, 521, 525
BstDEI CTNAG 5 cut(s) 288, 558, 638, 647, 764
BstF5I GGATG 1 cut(s) 982
BstKTI GATC 4 cut(s) 96, 159, 444, 801
BstMAI GTCTC 5 cut(s) 131, 499, 852, 914, 1058
BstMBI GATC 4 cut(s) 93, 156, 441, 798
BstMWI GCNNNNNNNGC 7 cut(s) 88, 394, 430, 648, 986, 1075, 1112
BstNI CCWGG 1 cut(s) 42
BstNSI RCATGY 1 cut(s) 879
BstSCI CCNGG 1 cut(s) 40
BstSLI GKGCMC 1 cut(s) 426
BstSNI TACGTA 1 cut(s) 954
BstV2I GAAGAC 1 cut(s) 571
BsuI GTATCC 1 cut(s) 801
BsuRI GGCC 3 cut(s) 77, 305, 749
BtsCI GGATG 1 cut(s) 982
BtsIMutI CAGTG 3 cut(s) 285, 498, 794
BveI ACCTGC 1 cut(s) 880
Cac8I GCNNGC 3 cut(s) 303, 521, 525
Cfr13I GGNCC 5 cut(s) 37, 75, 380, 713, 748
CseI GACGC 1 cut(s) 738
Csp6I GTAC 2 cut(s) 51, 682
CviAII CATG 7 cut(s) 68, 213, 277, 309, 364, 745, 876
CviQI GTAC 2 cut(s) 51, 682
DdeI CTNAG 5 cut(s) 288, 558, 638, 647, 764
DpnI GATC 4 cut(s) 95, 158, 443, 800
DpnII GATC 4 cut(s) 93, 156, 441, 798
Eam1104I CTCTTC 1 cut(s) 1011
EarI CTCTTC 1 cut(s) 1011
Eco105I TACGTA 1 cut(s) 954
Eco130I CCWWGG 1 cut(s) 375
Eco31I GGTCTC 1 cut(s) 131
Eco47I GGWCC 3 cut(s) 37, 380, 713
Eco88I CYCGRG 1 cut(s) 128
EcoO109I RGGNCCY 2 cut(s) 37, 75
EcoRII CCWGG 1 cut(s) 40
EcoT14I CCWWGG 1 cut(s) 375
EcoT22I ATGCAT 2 cut(s) 153, 583
ErhI CCWWGG 1 cut(s) 375
FaeI CATG 7 cut(s) 71, 216, 280, 312, 367, 748, 879
FaqI GGGAC 2 cut(s) 393, 456
FatI CATG 7 cut(s) 67, 212, 276, 308, 363, 744, 875
FokI GGATG 1 cut(s) 969
FspBI CTAG 4 cut(s) 261, 572, 1041, 1095
HaeIII GGCC 3 cut(s) 77, 305, 749
HapII CCGG 2 cut(s) 160, 986
HgaI GACGC 1 cut(s) 738
Hin1II CATG 7 cut(s) 71, 216, 280, 312, 367, 748, 879
HincII GTYRAC 1 cut(s) 961
HindII GTYRAC 1 cut(s) 961
HinfI GANTC 3 cut(s) 623, 922, 946
HpaII CCGG 2 cut(s) 160, 986
HphI GGTGA 1 cut(s) 1016
Hpy166II GTNNAC 1 cut(s) 961
Hpy188I TCNGA 7 cut(s) 202, 622, 639, 713, 807, 857, 903
Hpy188III TCNNGA 5 cut(s) 370, 830, 919, 969, 1027
Hpy8I GTNNAC 1 cut(s) 961
HpyCH4IV ACGT 3 cut(s) 233, 953, 992
HpyCH4V TGCA 7 cut(s) 4, 151, 271, 581, 815, 867, 875
HpyF10VI GCNNNNNNNGC 7 cut(s) 88, 394, 430, 648, 986, 1075, 1112
HpyF3I CTNAG 5 cut(s) 288, 558, 638, 647, 764
HpySE526I ACGT 3 cut(s) 233, 953, 992
Hsp92II CATG 7 cut(s) 71, 216, 280, 312, 367, 748, 879
Kzo9I GATC 4 cut(s) 93, 156, 441, 798
LmnI GCTCC 6 cut(s) 190, 223, 394, 406, 1111, 1120
LweI GCATC 3 cut(s) 897, 937, 1148
MaeI CTAG 4 cut(s) 261, 572, 1041, 1095
MaeII ACGT 3 cut(s) 233, 953, 992
MalI GATC 4 cut(s) 95, 158, 443, 800
MbiI CCGCTC 1 cut(s) 409
MboI GATC 4 cut(s) 93, 156, 441, 798
MboII GAAGA 4 cut(s) 576, 1015, 1028, 1042
MhlI GDGCHC 3 cut(s) 426, 894, 982
MluCI AATT 5 cut(s) 98, 510, 769, 1048, 1133
MlyI GAGTC 3 cut(s) 632, 916, 940
MmeI TCCRAC 2 cut(s) 212, 224
Mph1103I ATGCAT 2 cut(s) 153, 583
MseI TTAA 1 cut(s) 56
MspI CCGG 2 cut(s) 160, 986
MspR9I CCNGG 1 cut(s) 42
Mva1269I GAATGC 1 cut(s) 271
MvaI CCWGG 1 cut(s) 42
MwoI GCNNNNNNNGC 7 cut(s) 88, 394, 430, 648, 986, 1075, 1112
NdeII GATC 4 cut(s) 93, 156, 441, 798
NlaIII CATG 7 cut(s) 71, 216, 280, 312, 367, 748, 879
NlaIV GGNNCC 8 cut(s) 39, 186, 225, 381, 396, 750, 784, 1122
NsiI ATGCAT 2 cut(s) 153, 583
NspI RCATGY 1 cut(s) 879
PctI GAATGC 1 cut(s) 271
PleI GAGTC 3 cut(s) 631, 916, 940
PpsI GAGTC 3 cut(s) 631, 916, 940
Ppu21I YACGTR 1 cut(s) 954
PpuMI RGGWCCY 1 cut(s) 37
Psp5II RGGWCCY 1 cut(s) 37
Psp6I CCWGG 1 cut(s) 40
PspGI CCWGG 1 cut(s) 40
PspN4I GGNNCC 8 cut(s) 39, 186, 225, 381, 396, 750, 784, 1122
PspPI GGNCC 5 cut(s) 37, 75, 380, 713, 748
PspPPI RGGWCCY 1 cut(s) 37
RsaI GTAC 2 cut(s) 52, 683
RsaNI GTAC 2 cut(s) 51, 682
SaqAI TTAA 1 cut(s) 56
Sau3AI GATC 4 cut(s) 93, 156, 441, 798
Sau96I GGNCC 5 cut(s) 37, 75, 380, 713, 748
SchI GAGTC 3 cut(s) 632, 916, 940
ScrFI CCNGG 1 cut(s) 42
SduI GDGCHC 3 cut(s) 426, 894, 982
SfaNI GCATC 3 cut(s) 897, 937, 1148
SinI GGWCC 3 cut(s) 37, 380, 713
SmlI CTYRAG 2 cut(s) 318, 481
SmoI CTYRAG 2 cut(s) 318, 481
SnaBI TACGTA 1 cut(s) 954
Sse9I AATT 5 cut(s) 98, 510, 769, 1048, 1133
SsiI CCGC 2 cut(s) 409, 926
SspMI CTAG 4 cut(s) 261, 572, 1041, 1095
StyD4I CCNGG 1 cut(s) 40
StyI CCWWGG 1 cut(s) 375
TaiI ACGT 3 cut(s) 236, 956, 995
TaqI TCGA 3 cut(s) 440, 671, 918
TasI AATT 5 cut(s) 98, 510, 769, 1048, 1133
TatI WGTACW 1 cut(s) 50
Tru1I TTAA 1 cut(s) 56
Tru9I TTAA 1 cut(s) 56
TscAI CASTG 3 cut(s) 292, 498, 794
TspDTI ATGAA 7 cut(s) 293, 352, 477, 557, 615, 687, 753
TspGWI ACGGA 1 cut(s) 324
TspRI CASTG 3 cut(s) 292, 498, 794
VpaK11BI GGWCC 3 cut(s) 37, 380, 713
XapI RAATTY 1 cut(s) 510
XceI RCATGY 1 cut(s) 879
XspI CTAG 4 cut(s) 261, 572, 1041, 1095
Zsp2I ATGCAT 2 cut(s) 153, 583
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.