Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004757.1

Orthogroup ID

OG0008248

Physical Location & Seq

Genomic Coordinates Reverse (-)

27827 .. 31090

Gene Structure 3264 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004757.1_g000009.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1161 bp

atgcagtcaagggtgggggcattggaggaaagcaaggaccctggtggtagtacattaaaaaccagccatgtaagggccttgcctttgaggctgatccaattcctgttgatgtttgtggttctgggtctcggggtttccattttgagtatgcatacgatccggtatttcggtgttcaacatttggctccaacagaaccatctgatgtgaggtcatgttttgtggagccaaacacgttagaaagttggattagacctccatctagtctgttgcattccatgaatgacactgagttgctgtggctggcctcatgtgttcctcaagtgaaagaatatccgttcaaaagaactcccaagattgctttcatgttcttgaccaagggaccattgccgatggagcctctttgggagcggtttttcaaagggcacgaggggctttactcgatctatgtccattcgttgccatcttatagtcccaacttctcaagttcatcagtgttttacaagagacaaattccaagcaagctcgcagagtggggagagatgaatatgtgtgaggctgagagaagacttctagctaatgcattgcttgacatctcaaatgaatggtttgtcctcctttccgagtcttgtattcctctgagcaacctcagcattgtctatcactacttatcgaaatcaaggtacagctttatgggttcatttgacgaaatcggaccttatgggagaggacgctataatgaacacatggcccctttggtcaatctcagtaattggcgtaaaggttcccagtggtttgagatcaatcggatacttgcacataagattgttcaagacacaacttactaccctattttcagagacttttgcaaacctgcatgttatgtagatgagcactactttcagacgatgcttaccatcgagactccgcatcttttggcaaataggactcttacgtatgttgactggtcaagaggtggtgctcatccggctacgttcggtaaaggtgatattacagaagagttcttcaagaagattactactagcgaaaattgtctctacaacaatcagccgaccacgctctgtttcctttttgctagaaagtttgctccaagtgctttggagcctctgttagaattagcatctaaagtctttggatattga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Branch

Protein Analysis

386

Amino Acids

44.33

Weight (kDa)

8.04

Isoelectric Point (pI)

43.17

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008248)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G21310 AT3G21310 AT3G21310
fragaria_vesca	FvH4_6g32820 FvH4_6g32820 FvH4_6g32820
malus_domestica	MD09G1197900.v1.1 MD17G1178800.v1.1
prunus_persica	Prupe.3G053800_v2.0.a1 Prupe.3G053800_v2.0.a1 Prupe.3G053800_v2.0.a1
pyrus_communis	pycom09g11460
rosa_chinensis	RchiOBHm_Chr2g0142011
rosa_laevigata	RLG00000019946
rosa_multiflora	Rmu_sc0004757.1_g000009
rosa_roxburghii	Rroxscaffold_2G00103660
rosa_rugosa	Rorug02G0369700 Rorug02G0369800
rosa_samantha	Rh2AG422300 Rh2BG432600 Rh2CG409300 Rh2DG442300
rosa_wichuraiana	Rw2G034610

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	880
AccBSI	CCGCTC	1 cut(s)	409
AciI	CCGC	2 cut(s)	409, 926
AclWI	GGATC	2 cut(s)	88, 151
AcsI	RAATTY	1 cut(s)	510
AfaI	GTAC	2 cut(s)	52, 683
AfiI	CCNNNNNNNGG	1 cut(s)	73
AflIII	ACRYGT	1 cut(s)	231
AgsI	TTSAA	5 cut(s)	176, 340, 418, 830, 1027
AjnI	CCWGG	1 cut(s)	40
AjuI	GAANNNNNNNTTGG	2 cut(s)	344, 376
AluBI	AGCT	3 cut(s)	523, 575, 687
AluI	AGCT	3 cut(s)	523, 575, 687
Alw21I	GWGCWC	2 cut(s)	894, 982
Alw26I	GTCTC	5 cut(s)	131, 499, 852, 914, 1058
AlwI	GGATC	2 cut(s)	88, 151
Ama87I	CYCGRG	1 cut(s)	128
AoxI	GGCC	3 cut(s)	75, 303, 747
ApoI	RAATTY	1 cut(s)	510
AspS9I	GGNCC	5 cut(s)	37, 75, 380, 713, 748
AsuHPI	GGTGA	1 cut(s)	1016
AvaI	CYCGRG	1 cut(s)	128
AvaII	GGWCC	3 cut(s)	37, 380, 713
BaeGI	GKGCMC	1 cut(s)	426
BauI	CACGAG	1 cut(s)	425
BbsI	GAAGAC	1 cut(s)	571
Bbv12I	GWGCWC	2 cut(s)	894, 982
BbvCI	CCTCAGC	1 cut(s)	647
BccI	CCATC	5 cut(s)	205, 265, 385, 469, 923
BciT130I	CCWGG	1 cut(s)	42
BciVI	GTATCC	1 cut(s)	801
BcoDI	GTCTC	5 cut(s)	131, 499, 852, 914, 1058
BfaI	CTAG	4 cut(s)	261, 572, 1041, 1095
BfuAI	ACCTGC	1 cut(s)	880
BfuI	GTATCC	1 cut(s)	801
BglI	GCCNNNNNGGC	1 cut(s)	88
Bme1390I	CCNGG	1 cut(s)	42
Bme18I	GGWCC	3 cut(s)	37, 380, 713
BmeT110I	CYCGRG	1 cut(s)	128
BmgT120I	GGNCC	5 cut(s)	37, 75, 380, 713, 748
BmiI	GGNNCC	8 cut(s)	39, 186, 225, 381, 396, 750, 784, 1122
BmrFI	CCNGG	1 cut(s)	42
BmrI	ACTGGG	1 cut(s)	781
BmsI	GCATC	3 cut(s)	897, 937, 1148
BmuI	ACTGGG	1 cut(s)	781
BpiI	GAAGAC	1 cut(s)	571
Bpu10I	CCTNAGC	1 cut(s)	647
BpuEI	CTTGAG	2 cut(s)	303, 466
BsaAI	YACGTR	1 cut(s)	954
BsaI	GGTCTC	1 cut(s)	131
BsaJI	CCNNGG	2 cut(s)	40, 375
BsaWI	WCCGGW	1 cut(s)	159
BsaXI	ACNNNNNCTCC	2 cut(s)	1112, 1142
Bsc4I	CCNNNNNNNGG	1 cut(s)	73
Bse1I	ACTGG	2 cut(s)	787, 968
Bse3DI	GCAATG	2 cut(s)	383, 581
BseBI	CCWGG	1 cut(s)	42
BseDI	CCNNGG	2 cut(s)	40, 375
BseGI	GGATG	1 cut(s)	982
BseLI	CCNNNNNNNGG	1 cut(s)	73
BseMI	GCAATG	2 cut(s)	383, 581
BseMII	CTCAG	5 cut(s)	279, 549, 629, 661, 778
BseNI	ACTGG	2 cut(s)	787, 968
BseSI	GKGCMC	1 cut(s)	426
BshFI	GGCC	3 cut(s)	77, 305, 749
BsiHKAI	GWGCWC	2 cut(s)	894, 982
BsiHKCI	CYCGRG	1 cut(s)	128
BsiSI	CCGG	2 cut(s)	160, 986
BslFI	GGGAC	2 cut(s)	393, 456
BslI	CCNNNNNNNGG	1 cut(s)	73
BsmAI	GTCTC	5 cut(s)	131, 499, 852, 914, 1058
BsmFI	GGGAC	2 cut(s)	393, 456
BsmI	GAATGC	1 cut(s)	271
BsnI	GGCC	3 cut(s)	77, 305, 749
Bso31I	GGTCTC	1 cut(s)	131
BsoBI	CYCGRG	1 cut(s)	128
Bsp1286I	GDGCHC	3 cut(s)	426, 894, 982
Bsp143I	GATC	4 cut(s)	93, 156, 441, 798
BspACI	CCGC	2 cut(s)	409, 926
BspANI	GGCC	3 cut(s)	77, 305, 749
BspCNI	CTCAG	5 cut(s)	280, 550, 630, 660, 777
BspLI	GGNNCC	8 cut(s)	39, 186, 225, 381, 396, 750, 784, 1122
BspMI	ACCTGC	1 cut(s)	880
BspPI	GGATC	2 cut(s)	88, 151
BspTNI	GGTCTC	1 cut(s)	131
BsrBI	CCGCTC	1 cut(s)	409
BsrDI	GCAATG	2 cut(s)	383, 581
BsrI	ACTGG	2 cut(s)	787, 968
BssECI	CCNNGG	2 cut(s)	40, 375
BssMI	GATC	4 cut(s)	93, 156, 441, 798
BssSI	CACGAG	1 cut(s)	425
BssT1I	CCWWGG	1 cut(s)	375
Bst2BI	CACGAG	1 cut(s)	425
Bst2UI	CCWGG	1 cut(s)	42
Bst6I	CTCTTC	1 cut(s)	1011
BstBAI	YACGTR	1 cut(s)	954
BstC8I	GCNNGC	3 cut(s)	303, 521, 525
BstDEI	CTNAG	5 cut(s)	288, 558, 638, 647, 764
BstF5I	GGATG	1 cut(s)	982
BstKTI	GATC	4 cut(s)	96, 159, 444, 801
BstMAI	GTCTC	5 cut(s)	131, 499, 852, 914, 1058
BstMBI	GATC	4 cut(s)	93, 156, 441, 798
BstMWI	GCNNNNNNNGC	7 cut(s)	88, 394, 430, 648, 986, 1075, 1112
BstNI	CCWGG	1 cut(s)	42
BstNSI	RCATGY	1 cut(s)	879
BstSCI	CCNGG	1 cut(s)	40
BstSLI	GKGCMC	1 cut(s)	426
BstSNI	TACGTA	1 cut(s)	954
BstV2I	GAAGAC	1 cut(s)	571
BsuI	GTATCC	1 cut(s)	801
BsuRI	GGCC	3 cut(s)	77, 305, 749
BtsCI	GGATG	1 cut(s)	982
BtsIMutI	CAGTG	3 cut(s)	285, 498, 794
BveI	ACCTGC	1 cut(s)	880
Cac8I	GCNNGC	3 cut(s)	303, 521, 525
Cfr13I	GGNCC	5 cut(s)	37, 75, 380, 713, 748
CseI	GACGC	1 cut(s)	738
Csp6I	GTAC	2 cut(s)	51, 682
CviAII	CATG	7 cut(s)	68, 213, 277, 309, 364, 745, 876
CviQI	GTAC	2 cut(s)	51, 682
DdeI	CTNAG	5 cut(s)	288, 558, 638, 647, 764
DpnI	GATC	4 cut(s)	95, 158, 443, 800
DpnII	GATC	4 cut(s)	93, 156, 441, 798
Eam1104I	CTCTTC	1 cut(s)	1011
EarI	CTCTTC	1 cut(s)	1011
Eco105I	TACGTA	1 cut(s)	954
Eco130I	CCWWGG	1 cut(s)	375
Eco31I	GGTCTC	1 cut(s)	131
Eco47I	GGWCC	3 cut(s)	37, 380, 713
Eco88I	CYCGRG	1 cut(s)	128
EcoO109I	RGGNCCY	2 cut(s)	37, 75
EcoRII	CCWGG	1 cut(s)	40
EcoT14I	CCWWGG	1 cut(s)	375
EcoT22I	ATGCAT	2 cut(s)	153, 583
ErhI	CCWWGG	1 cut(s)	375
FaeI	CATG	7 cut(s)	71, 216, 280, 312, 367, 748, 879
FaqI	GGGAC	2 cut(s)	393, 456
FatI	CATG	7 cut(s)	67, 212, 276, 308, 363, 744, 875
FokI	GGATG	1 cut(s)	969
FspBI	CTAG	4 cut(s)	261, 572, 1041, 1095
HaeIII	GGCC	3 cut(s)	77, 305, 749
HapII	CCGG	2 cut(s)	160, 986
HgaI	GACGC	1 cut(s)	738
Hin1II	CATG	7 cut(s)	71, 216, 280, 312, 367, 748, 879
HincII	GTYRAC	1 cut(s)	961
HindII	GTYRAC	1 cut(s)	961
HinfI	GANTC	3 cut(s)	623, 922, 946
HpaII	CCGG	2 cut(s)	160, 986
HphI	GGTGA	1 cut(s)	1016
Hpy166II	GTNNAC	1 cut(s)	961
Hpy188I	TCNGA	7 cut(s)	202, 622, 639, 713, 807, 857, 903
Hpy188III	TCNNGA	5 cut(s)	370, 830, 919, 969, 1027
Hpy8I	GTNNAC	1 cut(s)	961
HpyCH4IV	ACGT	3 cut(s)	233, 953, 992
HpyCH4V	TGCA	7 cut(s)	4, 151, 271, 581, 815, 867, 875
HpyF10VI	GCNNNNNNNGC	7 cut(s)	88, 394, 430, 648, 986, 1075, 1112
HpyF3I	CTNAG	5 cut(s)	288, 558, 638, 647, 764
HpySE526I	ACGT	3 cut(s)	233, 953, 992
Hsp92II	CATG	7 cut(s)	71, 216, 280, 312, 367, 748, 879
Kzo9I	GATC	4 cut(s)	93, 156, 441, 798
LmnI	GCTCC	6 cut(s)	190, 223, 394, 406, 1111, 1120
LweI	GCATC	3 cut(s)	897, 937, 1148
MaeI	CTAG	4 cut(s)	261, 572, 1041, 1095
MaeII	ACGT	3 cut(s)	233, 953, 992
MalI	GATC	4 cut(s)	95, 158, 443, 800
MbiI	CCGCTC	1 cut(s)	409
MboI	GATC	4 cut(s)	93, 156, 441, 798
MboII	GAAGA	4 cut(s)	576, 1015, 1028, 1042
MhlI	GDGCHC	3 cut(s)	426, 894, 982
MluCI	AATT	5 cut(s)	98, 510, 769, 1048, 1133
MlyI	GAGTC	3 cut(s)	632, 916, 940
MmeI	TCCRAC	2 cut(s)	212, 224
Mph1103I	ATGCAT	2 cut(s)	153, 583
MseI	TTAA	1 cut(s)	56
MspI	CCGG	2 cut(s)	160, 986
MspR9I	CCNGG	1 cut(s)	42
Mva1269I	GAATGC	1 cut(s)	271
MvaI	CCWGG	1 cut(s)	42
MwoI	GCNNNNNNNGC	7 cut(s)	88, 394, 430, 648, 986, 1075, 1112
NdeII	GATC	4 cut(s)	93, 156, 441, 798
NlaIII	CATG	7 cut(s)	71, 216, 280, 312, 367, 748, 879
NlaIV	GGNNCC	8 cut(s)	39, 186, 225, 381, 396, 750, 784, 1122
NsiI	ATGCAT	2 cut(s)	153, 583
NspI	RCATGY	1 cut(s)	879
PctI	GAATGC	1 cut(s)	271
PleI	GAGTC	3 cut(s)	631, 916, 940
PpsI	GAGTC	3 cut(s)	631, 916, 940
Ppu21I	YACGTR	1 cut(s)	954
PpuMI	RGGWCCY	1 cut(s)	37
Psp5II	RGGWCCY	1 cut(s)	37
Psp6I	CCWGG	1 cut(s)	40
PspGI	CCWGG	1 cut(s)	40
PspN4I	GGNNCC	8 cut(s)	39, 186, 225, 381, 396, 750, 784, 1122
PspPI	GGNCC	5 cut(s)	37, 75, 380, 713, 748
PspPPI	RGGWCCY	1 cut(s)	37
RsaI	GTAC	2 cut(s)	52, 683
RsaNI	GTAC	2 cut(s)	51, 682
SaqAI	TTAA	1 cut(s)	56
Sau3AI	GATC	4 cut(s)	93, 156, 441, 798
Sau96I	GGNCC	5 cut(s)	37, 75, 380, 713, 748
SchI	GAGTC	3 cut(s)	632, 916, 940
ScrFI	CCNGG	1 cut(s)	42
SduI	GDGCHC	3 cut(s)	426, 894, 982
SfaNI	GCATC	3 cut(s)	897, 937, 1148
SinI	GGWCC	3 cut(s)	37, 380, 713
SmlI	CTYRAG	2 cut(s)	318, 481
SmoI	CTYRAG	2 cut(s)	318, 481
SnaBI	TACGTA	1 cut(s)	954
Sse9I	AATT	5 cut(s)	98, 510, 769, 1048, 1133
SsiI	CCGC	2 cut(s)	409, 926
SspMI	CTAG	4 cut(s)	261, 572, 1041, 1095
StyD4I	CCNGG	1 cut(s)	40
StyI	CCWWGG	1 cut(s)	375
TaiI	ACGT	3 cut(s)	236, 956, 995
TaqI	TCGA	3 cut(s)	440, 671, 918
TasI	AATT	5 cut(s)	98, 510, 769, 1048, 1133
TatI	WGTACW	1 cut(s)	50
Tru1I	TTAA	1 cut(s)	56
Tru9I	TTAA	1 cut(s)	56
TscAI	CASTG	3 cut(s)	292, 498, 794
TspDTI	ATGAA	7 cut(s)	293, 352, 477, 557, 615, 687, 753
TspGWI	ACGGA	1 cut(s)	324
TspRI	CASTG	3 cut(s)	292, 498, 794
VpaK11BI	GGWCC	3 cut(s)	37, 380, 713
XapI	RAATTY	1 cut(s)	510
XceI	RCATGY	1 cut(s)	879
XspI	CTAG	4 cut(s)	261, 572, 1041, 1095
Zsp2I	ATGCAT	2 cut(s)	153, 583

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.