Rmu_sc0004966.1_g000009

Belongs to the peroxisomal membrane protein PXMP2 4 family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004966.1
Physical Location & Seq
Reverse (-)
49741 .. 51629
1889 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004966.1_g000009.1.cds

Sequence Viewer

Length: 639 bp
atgctcagggtctggaaatggtaccagagctgcctctctcagcatccattgaagacccaggtcatcagctccggcgtcctctggggcgtcggcgacattgctgcccagtacattactcactccaccacaagaaaccgtcttcagctctctcacgacaaagctgaagatttcaaggttaactggaaacgagtagctatcacaagtacatttggctttgcttttgttggacctgttggccatttctggtacgaaaacttggacaagttcataaagttgaagcttcacctaaaacctaactcagcccggtttgttgctgctaaagtggcaatggatggtcttatctttggcccccttgatttgttggtgttcttcacctacatgggattttccactggcaagaatgctgatcaagtgaaggaagatttgaagagagatttcataccagccctcatgttggagggtggcgtgtggccaattgttcaagttgcaaatttcagatatgttcctgtgaggtatcagctcctctatgttaatatcttctgcctgttggacagtgcctttttgtcatgggtcgagcaacaaaaggatgctgcttggaagcaatggttaacatcttttgcatcttttaaagaccgataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

212

Amino Acids

24.49

Weight (kDa)

9.49

Isoelectric Point (pI)

23.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013374)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 21
AccB1I GGYRCC 1 cut(s) 21
AcoI YGGCCR 2 cut(s) 235, 470
AcsI RAATTY 1 cut(s) 490
AcuI CTGAAG 2 cut(s) 125, 183
AcyI GRCGYC 2 cut(s) 75, 87
AfaI GTAC 4 cut(s) 23, 110, 205, 248
AfiI CCNNNNNNNGG 1 cut(s) 454
AgsI TTSAA 5 cut(s) 52, 172, 277, 427, 482
AjnI CCWGG 1 cut(s) 57
AluBI AGCT 7 cut(s) 30, 69, 145, 161, 194, 280, 520
AluI AGCT 7 cut(s) 30, 69, 145, 161, 194, 280, 520
AlwNI CAGNNNCTG 1 cut(s) 12
AoxI GGCC 3 cut(s) 235, 346, 470
ApeKI GCWGC 4 cut(s) 30, 101, 314, 590
ApoI RAATTY 1 cut(s) 490
Asp718I GGTACC 1 cut(s) 21
AspS9I GGNCC 2 cut(s) 227, 347
AsuC2I CCSGG 1 cut(s) 304
AsuHPI GGTGA 2 cut(s) 275, 364
AvaII GGWCC 1 cut(s) 227
BalI TGGCCA 2 cut(s) 237, 472
BanI GGYRCC 1 cut(s) 21
BbsI GAAGAC 2 cut(s) 59, 131
BbvI GCAGC 4 cut(s) 17, 88, 301, 577
BccI CCATC 1 cut(s) 326
BcgI CGANNNNNNTGC 2 cut(s) 83, 117
BciT130I CCWGG 1 cut(s) 59
BclI TGATCA 1 cut(s) 406
BcnI CCSGG 1 cut(s) 304
BisI GCNGC 4 cut(s) 31, 102, 315, 591
BlsI GCNGC 4 cut(s) 32, 103, 316, 592
Bme1390I CCNGG 2 cut(s) 59, 304
Bme18I GGWCC 1 cut(s) 227
BmgT120I GGNCC 2 cut(s) 227, 347
BmiI GGNNCC 2 cut(s) 23, 349
BmrFI CCNGG 2 cut(s) 59, 304
BmrI ACTGGG 1 cut(s) 100
BmsI GCATC 3 cut(s) 52, 577, 629
BmuI ACTGGG 1 cut(s) 100
BoxI GACNNNNGTC 1 cut(s) 59
BpiI GAAGAC 2 cut(s) 59, 131
Bpu10I CCTNAGC 1 cut(s) 5
BpuMI CCSGG 1 cut(s) 304
BsaHI GRCGYC 2 cut(s) 75, 87
BsaJI CCNNGG 1 cut(s) 57
Bsc4I CCNNNNNNNGG 1 cut(s) 454
Bse1I ACTGG 3 cut(s) 106, 185, 397
Bse3DI GCAATG 3 cut(s) 96, 333, 608
BseBI CCWGG 1 cut(s) 59
BseDI CCNNGG 1 cut(s) 57
BseGI GGATG 3 cut(s) 43, 337, 592
BseLI CCNNNNNNNGG 1 cut(s) 454
BseMI GCAATG 3 cut(s) 96, 333, 608
BseMII CTCAG 3 cut(s) 19, 53, 312
BseNI ACTGG 3 cut(s) 106, 185, 397
BseRI GAGGAG 1 cut(s) 512
BseXI GCAGC 4 cut(s) 17, 88, 301, 577
BshFI GGCC 3 cut(s) 237, 348, 472
BshNI GGYRCC 1 cut(s) 21
BsiSI CCGG 2 cut(s) 72, 304
BslI CCNNNNNNNGG 1 cut(s) 454
BsmI GAATGC 1 cut(s) 406
BsnI GGCC 3 cut(s) 237, 348, 472
Bsp143I GATC 1 cut(s) 406
BspANI GGCC 3 cut(s) 237, 348, 472
BspCNI CTCAG 3 cut(s) 18, 52, 311
BspLI GGNNCC 2 cut(s) 23, 349
BspT107I GGYRCC 1 cut(s) 21
BsrDI GCAATG 3 cut(s) 96, 333, 608
BsrI ACTGG 3 cut(s) 106, 185, 397
BssECI CCNNGG 1 cut(s) 57
BssMI GATC 1 cut(s) 406
BssNI GRCGYC 2 cut(s) 75, 87
Bst2UI CCWGG 1 cut(s) 59
Bst4CI ACNGT 2 cut(s) 137, 554
Bst6I CTCTTC 1 cut(s) 422
BstACI GRCGYC 2 cut(s) 75, 87
BstDEI CTNAG 3 cut(s) 5, 39, 298
BstF5I GGATG 3 cut(s) 43, 337, 592
BstKTI GATC 1 cut(s) 409
BstMBI GATC 1 cut(s) 406
BstMWI GCNNNNNNNGC 1 cut(s) 323
BstNI CCWGG 1 cut(s) 59
BstPAI GACNNNNGTC 1 cut(s) 59
BstSCI CCNGG 2 cut(s) 57, 302
BstV1I GCAGC 4 cut(s) 17, 88, 301, 577
BstV2I GAAGAC 2 cut(s) 59, 131
BsuRI GGCC 3 cut(s) 237, 348, 472
BtsCI GGATG 3 cut(s) 43, 337, 592
BtsIMutI CAGTG 2 cut(s) 390, 559
CaiI CAGNNNCTG 1 cut(s) 12
Cfr13I GGNCC 2 cut(s) 227, 347
CseI GACGC 2 cut(s) 64, 76
Csp6I GTAC 4 cut(s) 22, 109, 204, 247
CviAII CATG 3 cut(s) 379, 451, 567
CviQI GTAC 4 cut(s) 22, 109, 204, 247
DdeI CTNAG 3 cut(s) 5, 39, 298
DpnI GATC 1 cut(s) 408
DpnII GATC 1 cut(s) 406
DraI TTTAAA 1 cut(s) 628
EaeI YGGCCR 2 cut(s) 235, 470
Eam1104I CTCTTC 1 cut(s) 422
EarI CTCTTC 1 cut(s) 422
Eco47I GGWCC 1 cut(s) 227
Eco57I CTGAAG 2 cut(s) 125, 183
EcoRII CCWGG 1 cut(s) 57
FaeI CATG 3 cut(s) 382, 454, 570
FaiI YATR 7 cut(s) 269, 380, 440, 452, 501, 528, 568
FatI CATG 3 cut(s) 378, 450, 566
FbaI TGATCA 1 cut(s) 406
Fnu4HI GCNGC 4 cut(s) 31, 102, 315, 591
FokI GGATG 3 cut(s) 30, 344, 599
Fsp4HI GCNGC 4 cut(s) 31, 102, 315, 591
GluI GCNGC 4 cut(s) 31, 102, 315, 591
HaeIII GGCC 3 cut(s) 237, 348, 472
HapII CCGG 2 cut(s) 72, 304
HgaI GACGC 2 cut(s) 64, 76
Hin1I GRCGYC 2 cut(s) 75, 87
Hin1II CATG 3 cut(s) 382, 454, 570
HincII GTYRAC 2 cut(s) 178, 609
HindII GTYRAC 2 cut(s) 178, 609
HindIII AAGCTT 1 cut(s) 278
HpaI GTTAAC 2 cut(s) 178, 609
HpaII CCGG 2 cut(s) 72, 304
HphI GGTGA 2 cut(s) 275, 364
Hpy166II GTNNAC 2 cut(s) 178, 609
Hpy188I TCNGA 1 cut(s) 497
Hpy188III TCNNGA 2 cut(s) 13, 152
Hpy8I GTNNAC 2 cut(s) 178, 609
Hpy99I CGWCG 1 cut(s) 92
HpyAV CCTTC 1 cut(s) 409
HpyCH4III ACNGT 2 cut(s) 137, 554
HpyCH4V TGCA 2 cut(s) 488, 620
HpyF10VI GCNNNNNNNGC 1 cut(s) 323
HpyF3I CTNAG 3 cut(s) 5, 39, 298
Hsp92I GRCGYC 2 cut(s) 75, 87
Hsp92II CATG 3 cut(s) 382, 454, 570
KpnI GGTACC 1 cut(s) 25
Ksp22I TGATCA 1 cut(s) 406
KspAI GTTAAC 2 cut(s) 178, 609
Kzo9I GATC 1 cut(s) 406
LmnI GCTCC 2 cut(s) 74, 525
Lsp1109I GCAGC 4 cut(s) 17, 88, 301, 577
LweI GCATC 3 cut(s) 52, 577, 629
MalI GATC 1 cut(s) 408
MboI GATC 1 cut(s) 406
MboII GAAGA 7 cut(s) 64, 131, 176, 361, 431, 439, 529
MfeI CAATTG 1 cut(s) 474
MlsI TGGCCA 2 cut(s) 237, 472
MluCI AATT 2 cut(s) 474, 490
MluNI TGGCCA 2 cut(s) 237, 472
MmeI TCCRAC 3 cut(s) 205, 435, 528
MnlI CCTC 6 cut(s) 44, 89, 451, 458, 504, 533
Mox20I TGGCCA 2 cut(s) 237, 472
MscI TGGCCA 2 cut(s) 237, 472
MseI TTAA 4 cut(s) 177, 531, 608, 627
MslI CAYNNNNRTG 1 cut(s) 377
Msp20I TGGCCA 2 cut(s) 237, 472
MspI CCGG 2 cut(s) 72, 304
MspR9I CCNGG 2 cut(s) 59, 304
MunI CAATTG 1 cut(s) 474
Mva1269I GAATGC 1 cut(s) 406
MvaI CCWGG 1 cut(s) 59
MwoI GCNNNNNNNGC 1 cut(s) 323
NciI CCSGG 1 cut(s) 304
NdeII GATC 1 cut(s) 406
NlaIII CATG 3 cut(s) 382, 454, 570
NlaIV GGNNCC 2 cut(s) 23, 349
PctI GAATGC 1 cut(s) 406
PkrI GCNGC 4 cut(s) 32, 103, 316, 592
PshAI GACNNNNGTC 1 cut(s) 59
Psp6I CCWGG 1 cut(s) 57
PspGI CCWGG 1 cut(s) 57
PspN4I GGNNCC 2 cut(s) 23, 349
PspPI GGNCC 2 cut(s) 227, 347
PstNI CAGNNNCTG 1 cut(s) 12
RsaI GTAC 4 cut(s) 23, 110, 205, 248
RsaNI GTAC 4 cut(s) 22, 109, 204, 247
RseI CAYNNNNRTG 1 cut(s) 377
SaqAI TTAA 4 cut(s) 177, 531, 608, 627
SatI GCNGC 4 cut(s) 31, 102, 315, 591
Sau3AI GATC 1 cut(s) 406
Sau96I GGNCC 2 cut(s) 227, 347
ScrFI CCNGG 2 cut(s) 59, 304
SfaNI GCATC 3 cut(s) 52, 577, 629
SinI GGWCC 1 cut(s) 227
SmiMI CAYNNNNRTG 1 cut(s) 377
Sse9I AATT 2 cut(s) 474, 490
StyD4I CCNGG 2 cut(s) 57, 302
TaaI ACNGT 2 cut(s) 137, 554
TaqI TCGA 1 cut(s) 573
TasI AATT 2 cut(s) 474, 490
TatI WGTACW 2 cut(s) 108, 203
Tru1I TTAA 4 cut(s) 177, 531, 608, 627
Tru9I TTAA 4 cut(s) 177, 531, 608, 627
TscAI CASTG 2 cut(s) 397, 559
TseI GCWGC 4 cut(s) 30, 101, 314, 590
TspDTI ATGAA 2 cut(s) 256, 427
TspRI CASTG 2 cut(s) 397, 559
VpaK11BI GGWCC 1 cut(s) 227
XapI RAATTY 1 cut(s) 490
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.