Rmu_sc0005356.1_g000001

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005356.1
Physical Location & Seq
Forward (+)
1 .. 3159
3159 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005356.1_g000001.1.cds

Sequence Viewer

Length: 303 bp
acggatgagaaggaaaaagtgcaaaatggaggtgaaaatgagagcttgagtggtggtggtggtggtactggagagagtgaaaaggttgaggaacaggggaatggggatgaagatagtgagtcgaattcgttgttgccgccgaggaaaggtggaatgtcgaggaagacgaataagacgaggcgaaaagtgcagtggaatgataggaatgggaataagcttgttgaggtgttagagtatgagccaagtgatgttagtgattctgatgacgaagatgcagattcttgcatatgtgtcattatgtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

100

Amino Acids

10.85

Weight (kDa)

4.37

Isoelectric Point (pI)

52.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012196)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 137
AcsI RAATTY 1 cut(s) 124
AfaI GTAC 1 cut(s) 67
AfiI CCNNNNNNNGG 1 cut(s) 146
AluBI AGCT 2 cut(s) 45, 217
AluI AGCT 2 cut(s) 45, 217
ApoI RAATTY 1 cut(s) 124
AsuHPI GGTGA 1 cut(s) 44
BbsI GAAGAC 1 cut(s) 170
BisI GCNGC 1 cut(s) 137
BlsI GCNGC 1 cut(s) 138
BmsI GCATC 1 cut(s) 262
BpiI GAAGAC 1 cut(s) 170
BpmI CTGGAG 1 cut(s) 90
BpuEI CTTGAG 1 cut(s) 67
BsaJI CCNNGG 1 cut(s) 140
Bsc4I CCNNNNNNNGG 1 cut(s) 146
Bse1I ACTGG 1 cut(s) 73
BseDI CCNNGG 1 cut(s) 140
BseGI GGATG 2 cut(s) 10, 112
BseLI CCNNNNNNNGG 1 cut(s) 146
BseNI ACTGG 1 cut(s) 73
BsgI GTGCAG 1 cut(s) 209
BslI CCNNNNNNNGG 1 cut(s) 146
BspACI CCGC 1 cut(s) 137
BsrI ACTGG 1 cut(s) 73
BssECI CCNNGG 1 cut(s) 140
BstF5I GGATG 2 cut(s) 10, 112
BstMWI GCNNNNNNNGC 1 cut(s) 187
BstV2I GAAGAC 1 cut(s) 170
BtsCI GGATG 2 cut(s) 10, 112
BtsI GCAGTG 1 cut(s) 197
BtsIMutI CAGTG 1 cut(s) 197
Csp6I GTAC 1 cut(s) 66
CviJI RGCY 3 cut(s) 45, 217, 241
CviKI_1 RGCY 3 cut(s) 45, 217, 241
CviQI GTAC 1 cut(s) 66
EcoRI GAATTC 1 cut(s) 124
FaiI YATR 4 cut(s) 237, 287, 289, 299
FauNDI CATATG 1 cut(s) 287
Fnu4HI GCNGC 1 cut(s) 137
FokI GGATG 2 cut(s) 17, 119
Fsp4HI GCNGC 1 cut(s) 137
GluI GCNGC 1 cut(s) 137
GsuI CTGGAG 1 cut(s) 90
HindIII AAGCTT 1 cut(s) 215
HinfI GANTC 3 cut(s) 119, 257, 278
HphI GGTGA 1 cut(s) 44
Hpy188I TCNGA 1 cut(s) 262
HpyAV CCTTC 1 cut(s) 4
HpyCH4V TGCA 4 cut(s) 22, 190, 275, 285
HpyF10VI GCNNNNNNNGC 1 cut(s) 187
LpnPI CCDG 2 cut(s) 54, 80
LweI GCATC 1 cut(s) 262
MboII GAAGA 3 cut(s) 122, 175, 281
MluCI AATT 1 cut(s) 124
MlyI GAGTC 1 cut(s) 128
MnlI CCTC 6 cut(s) 23, 82, 135, 153, 171, 217
MwoI GCNNNNNNNGC 1 cut(s) 187
NdeI CATATG 1 cut(s) 287
NmeAIII GCCGAG 1 cut(s) 165
PcsI WCGNNNNNNNCGW 2 cut(s) 164, 173
PfeI GAWTC 2 cut(s) 257, 278
PkrI GCNGC 1 cut(s) 138
PleI GAGTC 1 cut(s) 127
PpsI GAGTC 1 cut(s) 127
RsaI GTAC 1 cut(s) 67
RsaNI GTAC 1 cut(s) 66
SatI GCNGC 1 cut(s) 137
SchI GAGTC 1 cut(s) 128
SetI ASST 6 cut(s) 34, 47, 87, 151, 219, 228
SfaNI GCATC 1 cut(s) 262
SgeI CNNG 9 cut(s) 58, 81, 107, 153, 171, 189, 230, 255, 294
SmlI CTYRAG 1 cut(s) 46
SmoI CTYRAG 1 cut(s) 46
Sse9I AATT 1 cut(s) 124
SsiI CCGC 1 cut(s) 137
TaqI TCGA 2 cut(s) 122, 158
TasI AATT 1 cut(s) 124
TauI GCSGC 1 cut(s) 139
TfiI GAWTC 2 cut(s) 257, 278
TscAI CASTG 1 cut(s) 197
TspDTI ATGAA 1 cut(s) 123
TspGWI ACGGA 1 cut(s) 17
TspRI CASTG 1 cut(s) 197
XapI RAATTY 1 cut(s) 124
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.