Rh4CG060000

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
Physical Location & Seq
Reverse (-)
11450375 .. 11453405
3031 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG060000.1

Sequence Viewer

Length: 306 bp
ATGGAGACGGATGAGAAGGAGAAAGTGCAAAATGGAGGTGAAAATGAGAGCTTGAGTGGTGGTGGTGGGGCTGGAGAGAGTGAAAAGGTTGAGGAACAGGGGAATGGGGATGAAGATAGTGAGTCGAATTCGTTGTTGCCGCCGAGGAAAGGTGGAATGTCGAGGAAGACGAATAAGACTAGGCGAAAAGTGCAGTGGAATGATAGGAATGGGAATAAGCTTGTTGAGGTGTTAGAGTATGAGCCAAGTGATGTTAGTGATTCTGATGACGAAGATGCAGATTCTTGCATATGTGTCATTATGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

101

Amino Acids

11.02

Weight (kDa)

4.34

Isoelectric Point (pI)

52.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012196)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 140
AcsI RAATTY 1 cut(s) 127
AfiI CCNNNNNNNGG 1 cut(s) 149
AluBI AGCT 2 cut(s) 51, 220
AluI AGCT 2 cut(s) 51, 220
ApoI RAATTY 1 cut(s) 127
AsuHPI GGTGA 1 cut(s) 50
BbsI GAAGAC 1 cut(s) 173
BfaI CTAG 1 cut(s) 180
BisI GCNGC 1 cut(s) 140
BlsI GCNGC 1 cut(s) 141
BmsI GCATC 1 cut(s) 265
BpiI GAAGAC 1 cut(s) 173
BpmI CTGGAG 1 cut(s) 93
BpuEI CTTGAG 1 cut(s) 73
BsaJI CCNNGG 1 cut(s) 143
Bsc4I CCNNNNNNNGG 1 cut(s) 149
BseDI CCNNGG 1 cut(s) 143
BseGI GGATG 2 cut(s) 16, 115
BseLI CCNNNNNNNGG 1 cut(s) 149
BsgI GTGCAG 1 cut(s) 212
BslI CCNNNNNNNGG 1 cut(s) 149
BspACI CCGC 1 cut(s) 140
BssECI CCNNGG 1 cut(s) 143
BstF5I GGATG 2 cut(s) 16, 115
BstMWI GCNNNNNNNGC 1 cut(s) 190
BstV2I GAAGAC 1 cut(s) 173
BtsCI GGATG 2 cut(s) 16, 115
BtsI GCAGTG 1 cut(s) 200
BtsIMutI CAGTG 1 cut(s) 200
CviJI RGCY 4 cut(s) 51, 71, 220, 244
CviKI_1 RGCY 4 cut(s) 51, 71, 220, 244
EcoRI GAATTC 1 cut(s) 127
FaiI YATR 4 cut(s) 240, 290, 292, 302
FauNDI CATATG 1 cut(s) 290
Fnu4HI GCNGC 1 cut(s) 140
FokI GGATG 2 cut(s) 23, 122
Fsp4HI GCNGC 1 cut(s) 140
FspBI CTAG 1 cut(s) 180
GluI GCNGC 1 cut(s) 140
GsuI CTGGAG 1 cut(s) 93
HindIII AAGCTT 1 cut(s) 218
HinfI GANTC 3 cut(s) 122, 260, 281
HphI GGTGA 1 cut(s) 50
Hpy188I TCNGA 1 cut(s) 265
HpyAV CCTTC 1 cut(s) 10
HpyCH4V TGCA 4 cut(s) 28, 193, 278, 288
HpyF10VI GCNNNNNNNGC 1 cut(s) 190
LpnPI CCDG 2 cut(s) 57, 83
LweI GCATC 1 cut(s) 265
MaeI CTAG 1 cut(s) 180
MboII GAAGA 3 cut(s) 125, 178, 284
MluCI AATT 1 cut(s) 127
MlyI GAGTC 1 cut(s) 131
MnlI CCTC 5 cut(s) 29, 85, 138, 156, 220
MwoI GCNNNNNNNGC 1 cut(s) 190
NdeI CATATG 1 cut(s) 290
NmeAIII GCCGAG 1 cut(s) 168
PcsI WCGNNNNNNNCGW 1 cut(s) 167
PfeI GAWTC 2 cut(s) 260, 281
PkrI GCNGC 1 cut(s) 141
PleI GAGTC 1 cut(s) 130
PpsI GAGTC 1 cut(s) 130
SatI GCNGC 1 cut(s) 140
SchI GAGTC 1 cut(s) 131
SetI ASST 6 cut(s) 40, 53, 90, 154, 222, 231
SfaNI GCATC 1 cut(s) 265
SgeI CNNG 9 cut(s) 64, 84, 110, 156, 174, 192, 233, 258, 297
SmlI CTYRAG 1 cut(s) 52
SmoI CTYRAG 1 cut(s) 52
Sse9I AATT 1 cut(s) 127
SsiI CCGC 1 cut(s) 140
SspMI CTAG 1 cut(s) 180
TaqI TCGA 2 cut(s) 125, 161
TasI AATT 1 cut(s) 127
TauI GCSGC 1 cut(s) 142
TfiI GAWTC 2 cut(s) 260, 281
TscAI CASTG 1 cut(s) 200
TspDTI ATGAA 1 cut(s) 126
TspGWI ACGGA 1 cut(s) 23
TspRI CASTG 1 cut(s) 200
XapI RAATTY 1 cut(s) 127
XspI CTAG 1 cut(s) 180
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.