Rmu_sc0005381.1_g000005

Fatty-acid-binding protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005381.1
Physical Location & Seq
Reverse (-)
43127 .. 46251
3125 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005381.1_g000005.1.cds

Sequence Viewer

Length: 1281 bp
atgaagaataattggttttggtttggggattttgatgacgggtctttgtacaactttccgctggagcctctgattttgcatagttttgggggtcatgtgttttcacatattagttcatttatggacaattcattgcaccattgtagatactttcatgtgcctggaagcttagctcttgaaggtgcgtttaatcatatttcaaagtttgctggtgctttactagtgatgttctcttctgggaccagtacaaatgctactagggtaatagcaggtaacttggatggttttgaacctggaacctccagttcttctgcacaagtaaaacacattacttcaagtagacaaaaattcaaaggatttcacttcagttttgggccaaaaggagaatgtaataaccccatggattttggtaagatatcggcttttgtaatgcaattcctacaaagagaagctgaaaggcgatattcatattccttgctctcgttagctactgctcttgtaccaccttttggcaacttatcttcaaacatgttagctgtttcatcagcgaacactgacgttatggatcaaaggccttgtgaggttggacgccaaggatgtgctggtctaccttttcccaatttggactggagaatacatgcagtggagcctagaactggcattgagttccctatggttttggacaatattttaagagcagggaacaattccagtttaagttcagaggtccttgtggggactggatccagaacaatgacaataattagaataaaatctctgaagctctatgcgtttggcttttatattcatccttactctgtttgcaagaaattgggtccaaaatatgcttctgtttcagctgatgaactaaacaaacgccatgatttttatcaggaccttctcagggaagatattgatatgacagttaggcttgtggttagttgcaatggcatgaaaatcaatactgtgagagatgcttttgagaaatcccttcgagcccgattagtgaagacaaacccagagactgactatcgttgcataacaacatttggttcaaacttcacacaagatattccattgccagcgggaacaacaattgattttcaacgaacagctgatggaaaattgattactaaaattggagataatcagattggagcagtccaaagcaaggaactgtgcagggctttctttgacatgtacctgggagatggtcctgtgtcagagcagacaaaagaagagattggcagaaatgttgctagtatcattaggcgttgctga

Protein Analysis

426

Amino Acids

47.38

Weight (kDa)

8.49

Isoelectric Point (pI)

36.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 260
AccB7I CCANNNNNTGG 1 cut(s) 509
AccI GTMKAC 2 cut(s) 340, 607
AciI CCGC 2 cut(s) 59, 1085
AclWI GGATC 3 cut(s) 573, 738, 751
AcsI RAATTY 1 cut(s) 347
AcuI CTGAAG 2 cut(s) 349, 800
AcyI GRCGYC 1 cut(s) 589
AfaI GTAC 4 cut(s) 50, 247, 501, 1202
AfiI CCNNNNNNNGG 4 cut(s) 509, 656, 904, 1171
AflIII ACRYGT 2 cut(s) 528, 1197
AgsI TTSAA 8 cut(s) 179, 201, 290, 336, 352, 525, 1056, 1106
AhlI ACTAGT 1 cut(s) 220
AjnI CCWGG 3 cut(s) 160, 292, 1203
AjuI GAANNNNNNNTTGG 2 cut(s) 832, 864
AluBI AGCT 8 cut(s) 168, 173, 452, 488, 536, 784, 860, 1115
AluI AGCT 8 cut(s) 168, 173, 452, 488, 536, 784, 860, 1115
Alw26I GTCTC 1 cut(s) 1016
AlwI GGATC 3 cut(s) 573, 738, 751
AlwNI CAGNNNCTG 1 cut(s) 1025
AoxI GGCC 2 cut(s) 374, 572
ApoI RAATTY 1 cut(s) 347
AspS9I GGNCC 6 cut(s) 240, 374, 727, 836, 895, 1214
AvaII GGWCC 5 cut(s) 240, 727, 836, 895, 1214
BamHI GGATCC 1 cut(s) 743
BanII GRGCYC 1 cut(s) 1000
BbsI GAAGAC 1 cut(s) 1016
BccI CCATC 3 cut(s) 275, 1112, 1205
BciT130I CCWGG 3 cut(s) 162, 294, 1205
BcoDI GTCTC 1 cut(s) 1016
BcuI ACTAGT 1 cut(s) 220
BfaI CTAG 4 cut(s) 221, 258, 651, 1260
BfuAI ACCTGC 1 cut(s) 260
BlpI GCTNAGC 1 cut(s) 169
Bme1390I CCNGG 3 cut(s) 162, 294, 1205
Bme18I GGWCC 5 cut(s) 240, 727, 836, 895, 1214
BmgT120I GGNCC 6 cut(s) 240, 374, 727, 836, 895, 1214
BmiI GGNNCC 6 cut(s) 66, 241, 298, 648, 745, 837
BmrFI CCNGG 3 cut(s) 162, 294, 1205
BmsI GCATC 1 cut(s) 964
BpiI GAAGAC 1 cut(s) 1016
BpmI CTGGAG 3 cut(s) 83, 286, 649
Bpu1102I GCTNAGC 1 cut(s) 169
BsaBI GATNNNNATC 1 cut(s) 888
BsaHI GRCGYC 1 cut(s) 589
BsaJI CCNNGG 3 cut(s) 399, 592, 1204
Bsc4I CCNNNNNNNGG 4 cut(s) 509, 656, 904, 1171
Bse1I ACTGG 6 cut(s) 243, 303, 632, 661, 711, 745
Bse3DI GCAATG 3 cut(s) 131, 952, 1076
Bse8I GATNNNNATC 1 cut(s) 888
BseBI CCWGG 3 cut(s) 162, 294, 1205
BseDI CCNNGG 3 cut(s) 399, 592, 1204
BseGI GGATG 3 cut(s) 286, 602, 808
BseJI GATNNNNATC 1 cut(s) 888
BseLI CCNNNNNNNGG 4 cut(s) 509, 656, 904, 1171
BseMI GCAATG 3 cut(s) 131, 952, 1076
BseMII CTCAG 1 cut(s) 916
BseNI ACTGG 6 cut(s) 243, 303, 632, 661, 711, 745
BsgI GTGCAG 2 cut(s) 297, 1201
BshFI GGCC 2 cut(s) 376, 574
BslFI GGGAC 2 cut(s) 253, 751
BslI CCNNNNNNNGG 4 cut(s) 509, 656, 904, 1171
BsmAI GTCTC 1 cut(s) 1016
BsmFI GGGAC 2 cut(s) 253, 751
BsnI GGCC 2 cut(s) 376, 574
Bsp1286I GDGCHC 1 cut(s) 1000
Bsp1407I TGTACA 1 cut(s) 48
Bsp143I GATC 2 cut(s) 565, 743
Bsp1720I GCTNAGC 1 cut(s) 169
Bsp19I CCATGG 1 cut(s) 399
BspACI CCGC 2 cut(s) 59, 1085
BspANI GGCC 2 cut(s) 376, 574
BspCNI CTCAG 1 cut(s) 915
BspLI GGNNCC 6 cut(s) 66, 241, 298, 648, 745, 837
BspMI ACCTGC 1 cut(s) 260
BspPI GGATC 3 cut(s) 573, 738, 751
BsrDI GCAATG 3 cut(s) 131, 952, 1076
BsrGI TGTACA 1 cut(s) 48
BsrI ACTGG 6 cut(s) 243, 303, 632, 661, 711, 745
BssECI CCNNGG 3 cut(s) 399, 592, 1204
BssMI GATC 2 cut(s) 565, 743
BssNI GRCGYC 1 cut(s) 589
BssT1I CCWWGG 2 cut(s) 399, 592
Bst2UI CCWGG 3 cut(s) 162, 294, 1205
Bst4CI ACNGT 3 cut(s) 925, 967, 1179
Bst6I CTCTTC 2 cut(s) 238, 1233
BstACI GRCGYC 1 cut(s) 589
BstAUI TGTACA 1 cut(s) 48
BstC8I GCNNGC 1 cut(s) 1083
BstDEI CTNAG 2 cut(s) 169, 902
BstDSI CCRYGG 1 cut(s) 399
BstF5I GGATG 3 cut(s) 286, 602, 808
BstKTI GATC 2 cut(s) 568, 746
BstMAI GTCTC 1 cut(s) 1016
BstMBI GATC 2 cut(s) 565, 743
BstNI CCWGG 3 cut(s) 162, 294, 1205
BstNSI RCATGY 3 cut(s) 532, 641, 1201
BstSCI CCNGG 3 cut(s) 160, 292, 1203
BstV2I GAAGAC 1 cut(s) 1016
BstX2I RGATCY 1 cut(s) 743
BstYI RGATCY 1 cut(s) 743
BsuRI GGCC 2 cut(s) 376, 574
BtgI CCRYGG 1 cut(s) 399
BtsCI GGATG 3 cut(s) 286, 602, 808
BtsI GCAGTG 1 cut(s) 648
BtsIMutI CAGTG 2 cut(s) 552, 648
BveI ACCTGC 1 cut(s) 260
Cac8I GCNNGC 1 cut(s) 1083
CaiI CAGNNNCTG 1 cut(s) 1025
Cfr13I GGNCC 6 cut(s) 240, 374, 727, 836, 895, 1214
CseI GACGC 1 cut(s) 597
Csp6I GTAC 4 cut(s) 49, 246, 500, 1201
CviAII CATG 8 cut(s) 95, 155, 400, 529, 638, 881, 952, 1198
CviQI GTAC 4 cut(s) 49, 246, 500, 1201
DdeI CTNAG 2 cut(s) 169, 902
DpnI GATC 2 cut(s) 567, 745
DpnII GATC 2 cut(s) 565, 743
Eam1104I CTCTTC 2 cut(s) 238, 1233
EarI CTCTTC 2 cut(s) 238, 1233
Eco130I CCWWGG 2 cut(s) 399, 592
Eco147I AGGCCT 1 cut(s) 574
Eco24I GRGCYC 1 cut(s) 1000
Eco32I GATATC 1 cut(s) 417
Eco47I GGWCC 5 cut(s) 240, 727, 836, 895, 1214
Eco57I CTGAAG 2 cut(s) 349, 800
EcoO109I RGGNCCY 2 cut(s) 727, 895
EcoRII CCWGG 3 cut(s) 160, 292, 1203
EcoRV GATATC 1 cut(s) 417
EcoT14I CCWWGG 2 cut(s) 399, 592
EcoT38I GRGCYC 1 cut(s) 1000
ErhI CCWWGG 2 cut(s) 399, 592
FaeI CATG 8 cut(s) 98, 158, 403, 532, 641, 884, 955, 1201
FaqI GGGAC 2 cut(s) 253, 751
FatI CATG 8 cut(s) 94, 154, 399, 528, 637, 880, 951, 1197
FauI CCCGC 1 cut(s) 1078
FblI GTMKAC 2 cut(s) 340, 607
FokI GGATG 3 cut(s) 293, 609, 795
FriOI GRGCYC 1 cut(s) 1000
FspBI CTAG 4 cut(s) 221, 258, 651, 1260
GsuI CTGGAG 3 cut(s) 83, 286, 649
HaeIII GGCC 2 cut(s) 376, 574
HgaI GACGC 1 cut(s) 597
Hin1I GRCGYC 1 cut(s) 589
Hin1II CATG 8 cut(s) 98, 158, 403, 532, 641, 884, 955, 1201
HindIII AAGCTT 1 cut(s) 166
Hpy166II GTNNAC 2 cut(s) 341, 608
Hpy188I TCNGA 5 cut(s) 72, 724, 780, 1152, 1225
Hpy188III TCNNGA 3 cut(s) 176, 747, 893
Hpy8I GTNNAC 2 cut(s) 341, 608
HpyAV CCTTC 3 cut(s) 173, 908, 1001
HpyCH4III ACNGT 3 cut(s) 925, 967, 1179
HpyCH4IV ACGT 1 cut(s) 558
HpyCH4V TGCA 9 cut(s) 79, 136, 314, 433, 641, 825, 945, 1038, 1182
HpyF3I CTNAG 2 cut(s) 169, 902
HpySE526I ACGT 1 cut(s) 558
Hsp92I GRCGYC 1 cut(s) 589
Hsp92II CATG 8 cut(s) 98, 158, 403, 532, 641, 884, 955, 1201
Kzo9I GATC 2 cut(s) 565, 743
LmnI GCTCC 3 cut(s) 64, 646, 1157
LweI GCATC 1 cut(s) 964
MaeI CTAG 4 cut(s) 221, 258, 651, 1260
MaeII ACGT 1 cut(s) 558
MaeIII GTNAC 1 cut(s) 272
MalI GATC 2 cut(s) 567, 745
MboI GATC 2 cut(s) 565, 743
MboII GAAGA 7 cut(s) 16, 225, 300, 513, 920, 1021, 1250
MfeI CAATTG 1 cut(s) 1095
MflI RGATCY 1 cut(s) 743
MhlI GDGCHC 1 cut(s) 1000
MmeI TCCRAC 1 cut(s) 565
MnlI CCTC 4 cut(s) 78, 310, 574, 718
MseI TTAA 3 cut(s) 189, 692, 716
MspA1I CMGCKG 4 cut(s) 61, 860, 1085, 1115
MspR9I CCNGG 3 cut(s) 162, 294, 1205
MunI CAATTG 1 cut(s) 1095
MvaI CCWGG 3 cut(s) 162, 294, 1205
NcoI CCATGG 1 cut(s) 399
NdeII GATC 2 cut(s) 565, 743
NlaIII CATG 8 cut(s) 98, 158, 403, 532, 641, 884, 955, 1201
NlaIV GGNNCC 6 cut(s) 66, 241, 298, 648, 745, 837
NspI RCATGY 3 cut(s) 532, 641, 1201
PceI AGGCCT 1 cut(s) 574
PciI ACATGT 2 cut(s) 528, 1197
PflMI CCANNNNNTGG 1 cut(s) 509
PpuMI RGGWCCY 2 cut(s) 727, 895
PscI ACATGT 2 cut(s) 528, 1197
Psp5II RGGWCCY 2 cut(s) 727, 895
Psp6I CCWGG 3 cut(s) 160, 292, 1203
PspGI CCWGG 3 cut(s) 160, 292, 1203
PspN4I GGNNCC 6 cut(s) 66, 241, 298, 648, 745, 837
PspPI GGNCC 6 cut(s) 240, 374, 727, 836, 895, 1214
PspPPI RGGWCCY 2 cut(s) 727, 895
PstNI CAGNNNCTG 1 cut(s) 1025
PsuI RGATCY 1 cut(s) 743
PvuII CAGCTG 2 cut(s) 860, 1115
RsaI GTAC 4 cut(s) 50, 247, 501, 1202
RsaNI GTAC 4 cut(s) 49, 246, 500, 1201
SaqAI TTAA 3 cut(s) 189, 692, 716
Sau3AI GATC 2 cut(s) 565, 743
Sau96I GGNCC 6 cut(s) 240, 374, 727, 836, 895, 1214
ScrFI CCNGG 3 cut(s) 162, 294, 1205
SduI GDGCHC 1 cut(s) 1000
SfaNI GCATC 1 cut(s) 964
SinI GGWCC 5 cut(s) 240, 727, 836, 895, 1214
SpeI ACTAGT 1 cut(s) 220
SseBI AGGCCT 1 cut(s) 574
SsiI CCGC 2 cut(s) 59, 1085
SspI AATATT 1 cut(s) 688
SspMI CTAG 4 cut(s) 221, 258, 651, 1260
StuI AGGCCT 1 cut(s) 574
StyD4I CCNGG 3 cut(s) 160, 292, 1203
StyI CCWWGG 2 cut(s) 399, 592
TaaI ACNGT 3 cut(s) 925, 967, 1179
TaiI ACGT 1 cut(s) 561
TaqI TCGA 1 cut(s) 994
TatI WGTACW 2 cut(s) 48, 245
Tru1I TTAA 3 cut(s) 189, 692, 716
Tru9I TTAA 3 cut(s) 189, 692, 716
TscAI CASTG 2 cut(s) 559, 648
TspDTI ATGAA 9 cut(s) 17, 105, 120, 143, 456, 531, 797, 879, 968
TspRI CASTG 2 cut(s) 559, 648
Van91I CCANNNNNTGG 1 cut(s) 509
VpaK11BI GGWCC 5 cut(s) 240, 727, 836, 895, 1214
XapI RAATTY 1 cut(s) 347
XceI RCATGY 3 cut(s) 532, 641, 1201
XcmI CCANNNNNNNNNTGG 1 cut(s) 599
XmiI GTMKAC 2 cut(s) 340, 607
XspI CTAG 4 cut(s) 221, 258, 651, 1260
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.