Rmu_sc0005762.1_g000009

Ribosomal protein-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005762.1
OG0019505
Physical Location & Seq
Reverse (-)
29804 .. 30202
399 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005762.1_g000009.1.cds

Sequence Viewer

Length: 399 bp
atgcaggagtcatatagaaaagacgtggagatggcttttggcattctccaagctcgttttgcaatagtaagaggacccgccagtggatgggatagagaggatctccaatacatcatgatgacctgcattattttgcacaacatgattgtcgatgatgagcatgaagataatgaagattcgtctattgacctcgatgatatccccaccagaccaaggaaagcacaaatatatgagaggtatgaggatgatcatgaggttgagcgcaactatcctgaacttgaggagttcatgacccgttaccagggggttagatgcccaattgtgcatagagtccttcaaggagatttggttaatcacctctggaacatgaagctgcaagcagagcagaaccgcagatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Plant_tran

Protein Analysis

132

Amino Acids

15.84

Weight (kDa)

4.8

Isoelectric Point (pI)

44.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 131
AccB7I CCANNNNNTGG 1 cut(s) 87
AciI CCGC 2 cut(s) 78, 391
AclWI GGATC 1 cut(s) 108
AfiI CCNNNNNNNGG 4 cut(s) 83, 87, 213, 301
AgsI TTSAA 1 cut(s) 338
AjiI CACGTC 1 cut(s) 25
AjnI CCWGG 1 cut(s) 300
AluBI AGCT 2 cut(s) 53, 373
AluI AGCT 2 cut(s) 53, 373
AlwI GGATC 1 cut(s) 108
ApeKI GCWGC 1 cut(s) 373
AspLEI GCGC 1 cut(s) 264
AspS9I GGNCC 1 cut(s) 74
AsuHPI GGTGA 1 cut(s) 347
AvaII GGWCC 1 cut(s) 74
BbvI GCAGC 1 cut(s) 360
BccI CCATC 2 cut(s) 25, 81
BciT130I CCWGG 1 cut(s) 302
BclI TGATCA 1 cut(s) 247
BfuAI ACCTGC 1 cut(s) 131
BisI GCNGC 1 cut(s) 374
BlsI GCNGC 1 cut(s) 375
Bme1390I CCNGG 1 cut(s) 302
Bme18I GGWCC 1 cut(s) 74
BmgBI CACGTC 1 cut(s) 25
BmgT120I GGNCC 1 cut(s) 74
BmiI GGNNCC 1 cut(s) 76
BmrFI CCNGG 1 cut(s) 302
BmsI GCATC 1 cut(s) 302
BplI GAGNNNNNCTC 2 cut(s) 87, 119
BpuEI CTTGAG 1 cut(s) 299
BsaJI CCNNGG 2 cut(s) 212, 301
BsaXI ACNNNNNCTCC 2 cut(s) 333, 363
Bsc4I CCNNNNNNNGG 4 cut(s) 83, 87, 213, 301
Bse1I ACTGG 1 cut(s) 81
BseBI CCWGG 1 cut(s) 302
BseDI CCNNGG 2 cut(s) 212, 301
BseGI GGATG 2 cut(s) 92, 250
BseLI CCNNNNNNNGG 4 cut(s) 83, 87, 213, 301
BseNI ACTGG 1 cut(s) 81
BseRI GAGGAG 1 cut(s) 296
BseXI GCAGC 1 cut(s) 360
BslI CCNNNNNNNGG 4 cut(s) 83, 87, 213, 301
BsmI GAATGC 1 cut(s) 42
Bsp143I GATC 2 cut(s) 100, 247
BspACI CCGC 2 cut(s) 78, 391
BspHI TCATGA 3 cut(s) 114, 250, 288
BspLI GGNNCC 1 cut(s) 76
BspMI ACCTGC 1 cut(s) 131
BspPI GGATC 1 cut(s) 108
BsrI ACTGG 1 cut(s) 81
BssECI CCNNGG 2 cut(s) 212, 301
BssMI GATC 2 cut(s) 100, 247
BssT1I CCWWGG 1 cut(s) 212
Bst2UI CCWGG 1 cut(s) 302
BstC8I GCNNGC 1 cut(s) 378
BstF5I GGATG 2 cut(s) 92, 250
BstHHI GCGC 1 cut(s) 264
BstKTI GATC 2 cut(s) 103, 250
BstMBI GATC 2 cut(s) 100, 247
BstMWI GCNNNNNNNGC 2 cut(s) 59, 382
BstNI CCWGG 1 cut(s) 302
BstSCI CCNGG 1 cut(s) 300
BstV1I GCAGC 1 cut(s) 360
BstX2I RGATCY 1 cut(s) 100
BstYI RGATCY 1 cut(s) 100
BtrI CACGTC 1 cut(s) 25
BtsCI GGATG 2 cut(s) 92, 250
BtsIMutI CAGTG 1 cut(s) 88
BveI ACCTGC 1 cut(s) 131
Cac8I GCNNGC 1 cut(s) 378
CciI TCATGA 3 cut(s) 114, 250, 288
CfoI GCGC 1 cut(s) 264
Cfr13I GGNCC 1 cut(s) 74
CviAII CATG 6 cut(s) 115, 142, 161, 251, 289, 367
CviJI RGCY 3 cut(s) 35, 53, 373
CviKI_1 RGCY 3 cut(s) 35, 53, 373
DpnI GATC 2 cut(s) 102, 249
DpnII GATC 2 cut(s) 100, 247
Eco130I CCWWGG 1 cut(s) 212
Eco32I GATATC 1 cut(s) 199
Eco47I GGWCC 1 cut(s) 74
EcoO109I RGGNCCY 1 cut(s) 74
EcoRII CCWGG 1 cut(s) 300
EcoRV GATATC 1 cut(s) 199
EcoT14I CCWWGG 1 cut(s) 212
ErhI CCWWGG 1 cut(s) 212
FaeI CATG 6 cut(s) 118, 145, 164, 254, 292, 370
FatI CATG 6 cut(s) 114, 141, 160, 250, 288, 366
FauI CCCGC 1 cut(s) 85
FbaI TGATCA 1 cut(s) 247
Fnu4HI GCNGC 1 cut(s) 374
FokI GGATG 2 cut(s) 99, 257
Fsp4HI GCNGC 1 cut(s) 374
GlaI GCGC 1 cut(s) 263
GluI GCNGC 1 cut(s) 374
HhaI GCGC 1 cut(s) 264
Hin1II CATG 6 cut(s) 118, 145, 164, 254, 292, 370
Hin6I GCGC 1 cut(s) 262
HinP1I GCGC 1 cut(s) 262
HinfI GANTC 3 cut(s) 8, 176, 330
HphI GGTGA 1 cut(s) 347
Hpy188III TCNNGA 5 cut(s) 115, 251, 272, 289, 361
HpyAV CCTTC 1 cut(s) 344
HpyCH4IV ACGT 1 cut(s) 24
HpyCH4V TGCA 6 cut(s) 4, 62, 126, 136, 325, 376
HpyF10VI GCNNNNNNNGC 2 cut(s) 59, 382
HpySE526I ACGT 1 cut(s) 24
Hsp92II CATG 6 cut(s) 118, 145, 164, 254, 292, 370
HspAI GCGC 1 cut(s) 262
Ksp22I TGATCA 1 cut(s) 247
Kzo9I GATC 2 cut(s) 100, 247
LpnPI CCDG 7 cut(s) 94, 136, 220, 285, 287, 314, 346
Lsp1109I GCAGC 1 cut(s) 360
LweI GCATC 1 cut(s) 302
MaeII ACGT 1 cut(s) 24
MaeIII GTNAC 1 cut(s) 296
MalI GATC 2 cut(s) 102, 249
MboI GATC 2 cut(s) 100, 247
MboII GAAGA 2 cut(s) 176, 185
MfeI CAATTG 1 cut(s) 318
MflI RGATCY 1 cut(s) 100
MluCI AATT 1 cut(s) 318
MlyI GAGTC 2 cut(s) 17, 339
MnlI CCTC 8 cut(s) 65, 91, 200, 228, 235, 247, 274, 368
MseI TTAA 1 cut(s) 351
MslI CAYNNNNRTG 1 cut(s) 116
MspR9I CCNGG 1 cut(s) 302
MunI CAATTG 1 cut(s) 318
Mva1269I GAATGC 1 cut(s) 42
MvaI CCWGG 1 cut(s) 302
MwoI GCNNNNNNNGC 2 cut(s) 59, 382
NdeII GATC 2 cut(s) 100, 247
NlaIII CATG 6 cut(s) 118, 145, 164, 254, 292, 370
NlaIV GGNNCC 1 cut(s) 76
PagI TCATGA 3 cut(s) 114, 250, 288
PctI GAATGC 1 cut(s) 42
PfeI GAWTC 1 cut(s) 176
PflMI CCANNNNNTGG 1 cut(s) 87
PkrI GCNGC 1 cut(s) 375
PleI GAGTC 2 cut(s) 16, 338
PpsI GAGTC 2 cut(s) 16, 338
PpuMI RGGWCCY 1 cut(s) 74
Psp5II RGGWCCY 1 cut(s) 74
Psp6I CCWGG 1 cut(s) 300
PspGI CCWGG 1 cut(s) 300
PspN4I GGNNCC 1 cut(s) 76
PspPI GGNCC 1 cut(s) 74
PspPPI RGGWCCY 1 cut(s) 74
PsuI RGATCY 1 cut(s) 100
RseI CAYNNNNRTG 1 cut(s) 116
SaqAI TTAA 1 cut(s) 351
SatI GCNGC 1 cut(s) 374
Sau3AI GATC 2 cut(s) 100, 247
Sau96I GGNCC 1 cut(s) 74
SchI GAGTC 2 cut(s) 17, 339
ScrFI CCNGG 1 cut(s) 302
SetI ASST 8 cut(s) 27, 55, 125, 192, 239, 258, 360, 375
SfaNI GCATC 1 cut(s) 302
SinI GGWCC 1 cut(s) 74
SmiMI CAYNNNNRTG 1 cut(s) 116
SmlI CTYRAG 1 cut(s) 278
SmoI CTYRAG 1 cut(s) 278
Sse9I AATT 1 cut(s) 318
SsiI CCGC 2 cut(s) 78, 391
StyD4I CCNGG 1 cut(s) 300
StyI CCWWGG 1 cut(s) 212
TaiI ACGT 1 cut(s) 27
TaqI TCGA 2 cut(s) 150, 192
TasI AATT 1 cut(s) 318
TfiI GAWTC 1 cut(s) 176
Tru1I TTAA 1 cut(s) 351
Tru9I TTAA 1 cut(s) 351
TscAI CASTG 1 cut(s) 88
TseI GCWGC 1 cut(s) 373
TspDTI ATGAA 4 cut(s) 177, 186, 277, 383
TspRI CASTG 1 cut(s) 88
Van91I CCANNNNNTGG 1 cut(s) 87
VpaK11BI GGWCC 1 cut(s) 74
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.