Rmu_sc0018284.1_g000002

Ribosomal protein-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0018284.1
OG0019505
Physical Location & Seq
Forward (+)
1235 .. 1597
363 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0018284.1_g000002.1.cds

Sequence Viewer

Length: 363 bp
atgcaggagtcatacagaaaagacgtggagagggcatttggaattctccaagctcgttttgaaatagtaagaggacccgcccgtgggtgggatagagaggatctccaatacatcatgatgatctgcattattttgcacaacatgattgtcgatgatgagcctgaagaagataaagagtcgcctattgaccccgatgatatccccaccaaaccaaggaaagcacaaatatatgagaggtatgaggatgatcatgaggttgaacacaaccgtcctgaacttgaggagttcatgacccattaccaaggggttagatgcccaattgtgcatagagtccttcaaggagatttggttaatcacctctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Plant_tran

Protein Analysis

120

Amino Acids

14.36

Weight (kDa)

4.81

Isoelectric Point (pI)

44.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 78
AclWI GGATC 1 cut(s) 108
AcsI RAATTY 1 cut(s) 42
AcuI CTGAAG 1 cut(s) 183
AfiI CCNNNNNNNGG 5 cut(s) 83, 84, 87, 88, 213
AgsI TTSAA 3 cut(s) 62, 260, 338
AjiI CACGTC 1 cut(s) 25
AluBI AGCT 1 cut(s) 53
AluI AGCT 1 cut(s) 53
AlwI GGATC 1 cut(s) 108
ApoI RAATTY 1 cut(s) 42
AspS9I GGNCC 1 cut(s) 74
AsuHPI GGTGA 1 cut(s) 347
AvaII GGWCC 1 cut(s) 74
BclI TGATCA 1 cut(s) 247
BfaI CTAG 1 cut(s) 361
Bme18I GGWCC 1 cut(s) 74
BmgBI CACGTC 1 cut(s) 25
BmgT120I GGNCC 1 cut(s) 74
BmiI GGNNCC 1 cut(s) 76
BmsI GCATC 1 cut(s) 302
BplI GAGNNNNNCTC 2 cut(s) 87, 119
BpuEI CTTGAG 1 cut(s) 299
BsaJI CCNNGG 3 cut(s) 82, 212, 301
BsaXI ACNNNNNCTCC 2 cut(s) 333, 363
Bsc4I CCNNNNNNNGG 5 cut(s) 83, 84, 87, 88, 213
BseDI CCNNGG 3 cut(s) 82, 212, 301
BseGI GGATG 1 cut(s) 250
BseLI CCNNNNNNNGG 5 cut(s) 83, 84, 87, 88, 213
BseRI GAGGAG 1 cut(s) 296
BslI CCNNNNNNNGG 5 cut(s) 83, 84, 87, 88, 213
Bsp143I GATC 3 cut(s) 100, 120, 247
BspACI CCGC 1 cut(s) 78
BspHI TCATGA 3 cut(s) 114, 250, 288
BspLI GGNNCC 1 cut(s) 76
BspPI GGATC 1 cut(s) 108
BssECI CCNNGG 3 cut(s) 82, 212, 301
BssMI GATC 3 cut(s) 100, 120, 247
BssT1I CCWWGG 2 cut(s) 212, 301
Bst4CI ACNGT 1 cut(s) 269
BstDSI CCRYGG 1 cut(s) 82
BstF5I GGATG 1 cut(s) 250
BstKTI GATC 3 cut(s) 103, 123, 250
BstMBI GATC 3 cut(s) 100, 120, 247
BstX2I RGATCY 1 cut(s) 100
BstYI RGATCY 1 cut(s) 100
BtgI CCRYGG 1 cut(s) 82
BtrI CACGTC 1 cut(s) 25
BtsCI GGATG 1 cut(s) 250
CciI TCATGA 3 cut(s) 114, 250, 288
Cfr13I GGNCC 1 cut(s) 74
CviAII CATG 4 cut(s) 115, 142, 251, 289
CviJI RGCY 2 cut(s) 53, 160
CviKI_1 RGCY 2 cut(s) 53, 160
DpnI GATC 3 cut(s) 102, 122, 249
DpnII GATC 3 cut(s) 100, 120, 247
Eco130I CCWWGG 2 cut(s) 212, 301
Eco32I GATATC 1 cut(s) 199
Eco47I GGWCC 1 cut(s) 74
Eco57I CTGAAG 1 cut(s) 183
EcoO109I RGGNCCY 1 cut(s) 74
EcoRI GAATTC 1 cut(s) 42
EcoRV GATATC 1 cut(s) 199
EcoT14I CCWWGG 2 cut(s) 212, 301
ErhI CCWWGG 2 cut(s) 212, 301
FaeI CATG 4 cut(s) 118, 145, 254, 292
FaiI YATR 9 cut(s) 13, 116, 143, 229, 231, 240, 252, 290, 327
FatI CATG 4 cut(s) 114, 141, 250, 288
FauI CCCGC 1 cut(s) 85
FbaI TGATCA 1 cut(s) 247
FokI GGATG 1 cut(s) 257
FspBI CTAG 1 cut(s) 361
Hin1II CATG 4 cut(s) 118, 145, 254, 292
HinfI GANTC 3 cut(s) 8, 176, 330
HphI GGTGA 1 cut(s) 347
Hpy188III TCNNGA 4 cut(s) 115, 251, 272, 289
HpyAV CCTTC 1 cut(s) 344
HpyCH4III ACNGT 1 cut(s) 269
HpyCH4IV ACGT 1 cut(s) 24
HpyCH4V TGCA 4 cut(s) 4, 126, 136, 325
HpySE526I ACGT 1 cut(s) 24
Hsp92II CATG 4 cut(s) 118, 145, 254, 292
Ksp22I TGATCA 1 cut(s) 247
Kzo9I GATC 3 cut(s) 100, 120, 247
LpnPI CCDG 2 cut(s) 174, 285
LweI GCATC 1 cut(s) 302
MaeI CTAG 1 cut(s) 361
MaeII ACGT 1 cut(s) 24
MalI GATC 3 cut(s) 102, 122, 249
MboI GATC 3 cut(s) 100, 120, 247
MboII GAAGA 2 cut(s) 176, 179
MfeI CAATTG 1 cut(s) 318
MflI RGATCY 1 cut(s) 100
MluCI AATT 2 cut(s) 42, 318
MlyI GAGTC 3 cut(s) 17, 185, 339
MnlI CCTC 7 cut(s) 24, 65, 91, 228, 235, 247, 274
MseI TTAA 1 cut(s) 351
MslI CAYNNNNRTG 1 cut(s) 116
MunI CAATTG 1 cut(s) 318
NdeII GATC 3 cut(s) 100, 120, 247
NlaIII CATG 4 cut(s) 118, 145, 254, 292
NlaIV GGNNCC 1 cut(s) 76
PagI TCATGA 3 cut(s) 114, 250, 288
PleI GAGTC 3 cut(s) 16, 184, 338
PpsI GAGTC 3 cut(s) 16, 184, 338
PpuMI RGGWCCY 1 cut(s) 74
Psp5II RGGWCCY 1 cut(s) 74
PspN4I GGNNCC 1 cut(s) 76
PspPI GGNCC 1 cut(s) 74
PspPPI RGGWCCY 1 cut(s) 74
PsuI RGATCY 1 cut(s) 100
RseI CAYNNNNRTG 1 cut(s) 116
SaqAI TTAA 1 cut(s) 351
Sau3AI GATC 3 cut(s) 100, 120, 247
Sau96I GGNCC 1 cut(s) 74
SchI GAGTC 3 cut(s) 17, 185, 339
SetI ASST 5 cut(s) 27, 55, 239, 258, 360
SfaNI GCATC 1 cut(s) 302
SinI GGWCC 1 cut(s) 74
SmiMI CAYNNNNRTG 1 cut(s) 116
SmlI CTYRAG 1 cut(s) 278
SmoI CTYRAG 1 cut(s) 278
Sse9I AATT 2 cut(s) 42, 318
SsiI CCGC 1 cut(s) 78
SspMI CTAG 1 cut(s) 361
StyI CCWWGG 2 cut(s) 212, 301
TaaI ACNGT 1 cut(s) 269
TaiI ACGT 1 cut(s) 27
TaqI TCGA 1 cut(s) 150
TasI AATT 2 cut(s) 42, 318
Tru1I TTAA 1 cut(s) 351
Tru9I TTAA 1 cut(s) 351
TspDTI ATGAA 1 cut(s) 277
VpaK11BI GGWCC 1 cut(s) 74
XapI RAATTY 1 cut(s) 42
XspI CTAG 1 cut(s) 361
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.