Rmu_sc0006762.1_g000006

Sphingosine-1-phosphate

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006762.1
Physical Location & Seq
Reverse (-)
16597 .. 21673
5077 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006762.1_g000006.1.cds

Sequence Viewer

Length: 1647 bp
atggattcttcgtcggtgaaatcgttcctgctcggcgctcgagcttcggcgaattcgttcttggccggttacgagcctctggttctggtttcgacgcctctgattggactcttcgttgcgtcgacgcttcaatcgctgcttagtgttgtgcaggagaagggagtcaaggccactctgttagggctgttcatgagcttcatcaagctggttcctggagtgaagaagtacatagacgcggagaagcaaaaggtggtggataaattacagtctggtggtaactctaagagagaaaattggagaactgaattgcctggcgcagggttgggaccgggagttctggaacaaatgaaagacgagaaaagaaaagatgtggcttggcaaggcaaatgctcgggtacagtatatattggaggaagtgaattcgaaggacatttttctctaattaatgaggcatgctcaatgtttgcacataccaatccattacatatggatgtattccagagtgttgtacagtttgaagcagaagtggttgctatgacagctgcaatgcttggaagtaaaaaaaagtcttctggaggacaaatatgtggaaacatgacatcaggaggaactgaaagtatattactagctgtgaaaacatcacgtgattatatgaaagccaggaaggggattaaacaacctgaaatgataatacctgaatctgctcactcagcatacgacaaggctgcacaatattttaacatcaagctctggcgtgtcccagtagataaagagttccaagcagatgtcaaagccattagaagattcattaatagaaacactgttttgattgttggatctgcacctggttttcctcatggcattgttgatcctattgaggagcttggtcaattagcttctagctttgatatctgtctccatgtcgacctttgtcttgggggatttgtactaccttttgctcaaaagcttgggtatccgattccaccctttgatttttcagttaaaggagtgacatcaatatcagctgatgtgcataaatatgggttggctcctaaaggaacaagcataaacctccctaatgtgcttttcttttcatgtcatattggttcgtcggaatgctgggtttgtatgacttgttgtcatcagcatcaatttgtagctgttacagagtggtcaggagggttgtatgtatctccaacaatggctggaagcagacctggtagcttaattgcgggggcttgggcagctatgatggctttgggtgaggaagggtatttggaaaacacaaggtctatcatggaagtatccaaaaaacttcagaaggggataaaggatattcccgagttgttcatcattggacggccagacatgacagttgttgcatttggctctaacgttattgatatatttgaagtcaatgatatcatgtcatctaaaggctggcatttgaatgcattgcaaagacctaacagcattcatatatgtatgacacttcaacatgtaccaattcttgatgactttctgagggatctaaggcaatctgtgaaaactgtcaaagaaaatccaggtcccataagcggagggcttgctcccatttacggtgctgcagggaggatgccagatagagattcattggttaggttataa

Protein Analysis

548

Amino Acids

59.53

Weight (kDa)

8.36

Isoelectric Point (pI)

42.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0011402)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 1645
AccI GTMKAC 2 cut(s) 122, 924
AccII CGCG 1 cut(s) 236
AciI CCGC 3 cut(s) 236, 1232, 1578
AclI AACGTT 1 cut(s) 1395
AclWI GGATC 3 cut(s) 844, 863, 1536
AcoI YGGCCR 2 cut(s) 63, 1361
AcsI RAATTY 2 cut(s) 52, 419
AcuI CTGAAG 1 cut(s) 1301
AcvI CACGTG 1 cut(s) 644
AcyI GRCGYC 1 cut(s) 95
AfaI GTAC 5 cut(s) 227, 397, 510, 948, 1503
AfiI CCNNNNNNNGG 5 cut(s) 104, 317, 666, 1577, 1598
AflIII ACRYGT 1 cut(s) 1498
AgsI TTSAA 5 cut(s) 131, 518, 1412, 1450, 1496
AhdI GACNNNNNGTC 1 cut(s) 1137
AjnI CCWGG 6 cut(s) 211, 310, 659, 844, 1216, 1564
AjuI GAANNNNNNNTTGG 2 cut(s) 44, 76
AloI GAACNNNNNNTCC 2 cut(s) 318, 350
Alw26I GTCTC 1 cut(s) 920
AlwI GGATC 3 cut(s) 844, 863, 1536
Ama87I CYCGRG 3 cut(s) 39, 391, 1340
AoxI GGCC 3 cut(s) 63, 168, 1361
ApeKI GCWGC 5 cut(s) 136, 542, 725, 1244, 1604
ApoI RAATTY 2 cut(s) 52, 419
AseI ATTAAT 2 cut(s) 444, 810
Asp700I GAANNNNTTC 2 cut(s) 23, 56
AspLEI GCGC 2 cut(s) 38, 317
AspS9I GGNCC 2 cut(s) 326, 1568
AsuC2I CCSGG 1 cut(s) 330
AsuHPI GGTGA 2 cut(s) 28, 1274
AsuII TTCGAA 1 cut(s) 423
AvaI CYCGRG 3 cut(s) 39, 391, 1340
AvaII GGWCC 2 cut(s) 326, 1568
BbrPI CACGTG 1 cut(s) 644
BbsI GAAGAC 1 cut(s) 561
BbvI GCAGC 5 cut(s) 123, 529, 712, 1256, 1591
BccI CCATC 1 cut(s) 1246
BceAI ACGGC 1 cut(s) 1376
BcgI CGANNNNNNTGC 2 cut(s) 707, 741
BciT130I CCWGG 6 cut(s) 213, 312, 661, 846, 1218, 1566
BciVI GTATCC 2 cut(s) 984, 1315
BcnI CCSGG 1 cut(s) 330
BcoDI GTCTC 1 cut(s) 920
BfaI CTAG 2 cut(s) 626, 900
BfmI CTRYAG 1 cut(s) 1605
BfoI RGCGCY 1 cut(s) 39
BfuI GTATCC 2 cut(s) 984, 1315
BisI GCNGC 5 cut(s) 137, 543, 726, 1245, 1605
BlsI GCNGC 5 cut(s) 138, 544, 727, 1246, 1606
Bme1390I CCNGG 7 cut(s) 213, 312, 330, 661, 846, 1218, 1566
Bme18I GGWCC 2 cut(s) 326, 1568
BmeRI GACNNNNNGTC 1 cut(s) 1137
BmeT110I CYCGRG 3 cut(s) 39, 391, 1340
BmgT120I GGNCC 2 cut(s) 326, 1568
BmiI GGNNCC 4 cut(s) 210, 327, 1050, 1570
BmrFI CCNGG 7 cut(s) 213, 312, 330, 661, 846, 1218, 1566
BmrI ACTGGG 1 cut(s) 755
BmsI GCATC 2 cut(s) 1156, 1605
BmuI ACTGGG 1 cut(s) 755
BoxI GACNNNNGTC 1 cut(s) 930
BpiI GAAGAC 1 cut(s) 561
BplI GAGNNNNNCTC 2 cut(s) 440, 472
BpmI CTGGAG 2 cut(s) 234, 594
Bpu14I TTCGAA 1 cut(s) 423
BpuMI CCSGG 1 cut(s) 330
BsaAI YACGTR 1 cut(s) 644
BsaHI GRCGYC 1 cut(s) 95
Bsc4I CCNNNNNNNGG 5 cut(s) 104, 317, 666, 1577, 1598
Bse118I RCCGGY 1 cut(s) 65
Bse1I ACTGG 1 cut(s) 761
Bse3DI GCAATG 2 cut(s) 552, 1454
BseBI CCWGG 6 cut(s) 213, 312, 661, 846, 1218, 1566
BseGI GGATG 2 cut(s) 496, 1620
BseLI CCNNNNNNNGG 5 cut(s) 104, 317, 666, 1577, 1598
BseMI GCAATG 2 cut(s) 552, 1454
BseMII CTCAG 2 cut(s) 723, 1514
BseNI ACTGG 1 cut(s) 761
BseRI GAGGAG 1 cut(s) 893
BseXI GCAGC 5 cut(s) 123, 529, 712, 1256, 1591
BseYI CCCAGC 1 cut(s) 1119
BsgI GTGCAG 3 cut(s) 170, 711, 825
Bsh1236I CGCG 1 cut(s) 236
BshFI GGCC 3 cut(s) 65, 170, 1363
BsiHKCI CYCGRG 3 cut(s) 39, 391, 1340
BsiSI CCGG 2 cut(s) 66, 329
BslFI GGGAC 3 cut(s) 339, 743, 1554
BslI CCNNNNNNNGG 5 cut(s) 104, 317, 666, 1577, 1598
BsmAI GTCTC 1 cut(s) 920
BsmFI GGGAC 3 cut(s) 339, 743, 1554
BsmI GAATGC 3 cut(s) 1121, 1456, 1473
BsnI GGCC 3 cut(s) 65, 170, 1363
BsoBI CYCGRG 3 cut(s) 39, 391, 1340
Bsp119I TTCGAA 1 cut(s) 423
Bsp1407I TGTACA 1 cut(s) 508
Bsp143I GATC 3 cut(s) 836, 868, 1528
BspACI CCGC 3 cut(s) 236, 1232, 1578
BspANI GGCC 3 cut(s) 65, 170, 1363
BspCNI CTCAG 2 cut(s) 722, 1515
BspFNI CGCG 1 cut(s) 236
BspHI TCATGA 1 cut(s) 189
BspLI GGNNCC 4 cut(s) 210, 327, 1050, 1570
BspMAI CTGCAG 1 cut(s) 1609
BspPI GGATC 3 cut(s) 844, 863, 1536
BspT104I TTCGAA 1 cut(s) 423
BsrDI GCAATG 2 cut(s) 552, 1454
BsrFI RCCGGY 1 cut(s) 65
BsrGI TGTACA 1 cut(s) 508
BsrI ACTGG 1 cut(s) 761
BssAI RCCGGY 1 cut(s) 65
BssMI GATC 3 cut(s) 836, 868, 1528
BssNI GRCGYC 1 cut(s) 95
Bst2UI CCWGG 6 cut(s) 213, 312, 661, 846, 1218, 1566
Bst4CI ACNGT 7 cut(s) 267, 400, 513, 823, 1375, 1552, 1601
Bst6I CTCTTC 1 cut(s) 116
BstACI GRCGYC 1 cut(s) 95
BstAUI TGTACA 1 cut(s) 508
BstBAI YACGTR 1 cut(s) 644
BstBI TTCGAA 1 cut(s) 423
BstC8I GCNNGC 3 cut(s) 454, 1442, 1587
BstDEI CTNAG 5 cut(s) 140, 282, 709, 1523, 1532
BstENI CCTNNNNNAGG 1 cut(s) 315
BstF5I GGATG 2 cut(s) 496, 1620
BstFNI CGCG 1 cut(s) 236
BstH2I RGCGCY 1 cut(s) 39
BstHHI GCGC 2 cut(s) 38, 317
BstKTI GATC 3 cut(s) 839, 871, 1531
BstMAI GTCTC 1 cut(s) 920
BstMBI GATC 3 cut(s) 836, 868, 1528
BstMWI GCNNNNNNNGC 5 cut(s) 133, 539, 710, 1244, 1253
BstNI CCWGG 6 cut(s) 213, 312, 661, 846, 1218, 1566
BstNSI RCATGY 2 cut(s) 456, 1502
BstPAI GACNNNNGTC 1 cut(s) 930
BstSCI CCNGG 7 cut(s) 211, 310, 328, 659, 844, 1216, 1564
BstSFI CTRYAG 1 cut(s) 1605
BstUI CGCG 1 cut(s) 236
BstV1I GCAGC 5 cut(s) 123, 529, 712, 1256, 1591
BstV2I GAAGAC 1 cut(s) 561
BstX2I RGATCY 2 cut(s) 836, 1528
BstYI RGATCY 2 cut(s) 836, 1528
BsuI GTATCC 2 cut(s) 984, 1315
BsuRI GGCC 3 cut(s) 65, 170, 1363
BtsCI GGATG 2 cut(s) 496, 1620
BtsIMutI CAGTG 1 cut(s) 819
Cac8I GCNNGC 3 cut(s) 454, 1442, 1587
CciI TCATGA 1 cut(s) 189
CfoI GCGC 2 cut(s) 38, 317
Cfr10I RCCGGY 1 cut(s) 65
Cfr13I GGNCC 2 cut(s) 326, 1568
CseI GACGC 4 cut(s) 103, 108, 133, 242
CsiI ACCWGGT 2 cut(s) 844, 1216
Csp6I GTAC 5 cut(s) 226, 396, 509, 947, 1502
CviQI GTAC 5 cut(s) 226, 396, 509, 947, 1502
DdeI CTNAG 5 cut(s) 140, 282, 709, 1523, 1532
DpnI GATC 3 cut(s) 838, 870, 1530
DpnII GATC 3 cut(s) 836, 868, 1528
DriI GACNNNNNGTC 1 cut(s) 1137
EaeI YGGCCR 2 cut(s) 63, 1361
Eam1104I CTCTTC 1 cut(s) 116
Eam1105I GACNNNNNGTC 1 cut(s) 1137
EarI CTCTTC 1 cut(s) 116
Eco32I GATATC 2 cut(s) 910, 1423
Eco47I GGWCC 2 cut(s) 326, 1568
Eco57I CTGAAG 1 cut(s) 1301
Eco72I CACGTG 1 cut(s) 644
Eco88I CYCGRG 3 cut(s) 39, 391, 1340
EcoNI CCTNNNNNAGG 1 cut(s) 315
EcoO109I RGGNCCY 1 cut(s) 1568
EcoRI GAATTC 2 cut(s) 52, 419
EcoRII CCWGG 6 cut(s) 211, 310, 659, 844, 1216, 1564
EcoRV GATATC 2 cut(s) 910, 1423
EcoT22I ATGCAT 1 cut(s) 1456
FaqI GGGAC 3 cut(s) 339, 743, 1554
FauI CCCGC 1 cut(s) 1225
FauNDI CATATG 1 cut(s) 486
FblI GTMKAC 2 cut(s) 122, 924
Fnu4HI GCNGC 5 cut(s) 137, 543, 726, 1245, 1605
FokI GGATG 2 cut(s) 503, 1627
Fsp4HI GCNGC 5 cut(s) 137, 543, 726, 1245, 1605
FspBI CTAG 2 cut(s) 626, 900
GlaI GCGC 2 cut(s) 37, 316
GluI GCNGC 5 cut(s) 137, 543, 726, 1245, 1605
GsaI CCCAGC 1 cut(s) 1123
GsuI CTGGAG 2 cut(s) 234, 594
HaeII RGCGCY 1 cut(s) 39
HaeIII GGCC 3 cut(s) 65, 170, 1363
HapII CCGG 2 cut(s) 66, 329
HgaI GACGC 4 cut(s) 103, 108, 133, 242
HhaI GCGC 2 cut(s) 38, 317
Hin1I GRCGYC 1 cut(s) 95
Hin6I GCGC 2 cut(s) 36, 315
HinP1I GCGC 2 cut(s) 36, 315
HincII GTYRAC 2 cut(s) 123, 925
HindII GTYRAC 2 cut(s) 123, 925
HindIII AAGCTT 1 cut(s) 965
HinfI GANTC 7 cut(s) 5, 108, 162, 698, 804, 979, 1628
HpaII CCGG 2 cut(s) 66, 329
HphI GGTGA 2 cut(s) 28, 1274
Hpy166II GTNNAC 2 cut(s) 123, 925
Hpy188I TCNGA 5 cut(s) 102, 978, 1114, 1320, 1524
Hpy188III TCNNGA 8 cut(s) 190, 338, 499, 573, 603, 1176, 1340, 1511
Hpy8I GTNNAC 2 cut(s) 123, 925
Hpy99I CGWCG 5 cut(s) 16, 97, 124, 127, 1114
HpyAV CCTTC 5 cut(s) 151, 419, 658, 1262, 1315
HpyCH4III ACNGT 7 cut(s) 267, 400, 513, 823, 1375, 1552, 1601
HpyCH4IV ACGT 2 cut(s) 643, 1395
HpyF10VI GCNNNNNNNGC 5 cut(s) 133, 539, 710, 1244, 1253
HpyF3I CTNAG 5 cut(s) 140, 282, 709, 1523, 1532
HpySE526I ACGT 2 cut(s) 643, 1395
Hsp92I GRCGYC 1 cut(s) 95
HspAI GCGC 2 cut(s) 36, 315
Kzo9I GATC 3 cut(s) 836, 868, 1528
LmnI GCTCC 3 cut(s) 880, 1054, 1594
Lsp1109I GCAGC 5 cut(s) 123, 529, 712, 1256, 1591
LweI GCATC 2 cut(s) 1156, 1605
MabI ACCWGGT 2 cut(s) 844, 1216
MaeI CTAG 2 cut(s) 626, 900
MaeII ACGT 2 cut(s) 643, 1395
MaeIII GTNAC 4 cut(s) 68, 275, 1009, 1162
MalI GATC 3 cut(s) 838, 870, 1530
MboI GATC 3 cut(s) 836, 868, 1528
MboII GAAGA 4 cut(s) 103, 232, 561, 813
MflI RGATCY 2 cut(s) 836, 1528
MlyI GAGTC 2 cut(s) 102, 171
MmeI TCCRAC 3 cut(s) 814, 1092, 1220
Mph1103I ATGCAT 1 cut(s) 1456
MroXI GAANNNNTTC 2 cut(s) 23, 56
MseI TTAA 6 cut(s) 444, 672, 738, 810, 1002, 1226
MslI CAYNNNNRTG 3 cut(s) 489, 1038, 1449
MspA1I CMGCKG 2 cut(s) 542, 1025
MspI CCGG 2 cut(s) 66, 329
MspR9I CCNGG 7 cut(s) 213, 312, 330, 661, 846, 1218, 1566
Mva1269I GAATGC 3 cut(s) 1121, 1456, 1473
MvaI CCWGG 6 cut(s) 213, 312, 661, 846, 1218, 1566
MvnI CGCG 1 cut(s) 236
MwoI GCNNNNNNNGC 5 cut(s) 133, 539, 710, 1244, 1253
NciI CCSGG 1 cut(s) 330
NdeI CATATG 1 cut(s) 486
NdeII GATC 3 cut(s) 836, 868, 1528
NlaIV GGNNCC 4 cut(s) 210, 327, 1050, 1570
NmeAIII GCCGAG 1 cut(s) 12
NmuCI GTSAC 1 cut(s) 1009
NsiI ATGCAT 1 cut(s) 1456
NspI RCATGY 2 cut(s) 456, 1502
NspV TTCGAA 1 cut(s) 423
PaeI GCATGC 1 cut(s) 456
PaeR7I CTCGAG 1 cut(s) 39
PagI TCATGA 1 cut(s) 189
PciI ACATGT 1 cut(s) 1498
PcsI WCGNNNNNNNCGW 2 cut(s) 20, 53
PctI GAATGC 3 cut(s) 1121, 1456, 1473
PdmI GAANNNNTTC 2 cut(s) 23, 56
PfeI GAWTC 5 cut(s) 5, 698, 804, 979, 1628
PfoI TCCNGGA 1 cut(s) 211
PkrI GCNGC 5 cut(s) 138, 544, 727, 1246, 1606
PleI GAGTC 2 cut(s) 102, 170
PmaCI CACGTG 1 cut(s) 644
PmlI CACGTG 1 cut(s) 644
PpsI GAGTC 2 cut(s) 102, 170
Ppu21I YACGTR 1 cut(s) 644
PpuMI RGGWCCY 1 cut(s) 1568
PscI ACATGT 1 cut(s) 1498
PshAI GACNNNNGTC 1 cut(s) 930
PshBI ATTAAT 2 cut(s) 444, 810
PsiI TTATAA 1 cut(s) 1645
Psp1406I AACGTT 1 cut(s) 1395
Psp5II RGGWCCY 1 cut(s) 1568
Psp6I CCWGG 6 cut(s) 211, 310, 659, 844, 1216, 1564
PspCI CACGTG 1 cut(s) 644
PspFI CCCAGC 1 cut(s) 1119
PspGI CCWGG 6 cut(s) 211, 310, 659, 844, 1216, 1564
PspN4I GGNNCC 4 cut(s) 210, 327, 1050, 1570
PspPI GGNCC 2 cut(s) 326, 1568
PspPPI RGGWCCY 1 cut(s) 1568
PspXI VCTCGAGB 1 cut(s) 39
PstI CTGCAG 1 cut(s) 1609
PsuI RGATCY 2 cut(s) 836, 1528
PvuII CAGCTG 2 cut(s) 542, 1025
RsaI GTAC 5 cut(s) 227, 397, 510, 948, 1503
RsaNI GTAC 5 cut(s) 226, 396, 509, 947, 1502
RseI CAYNNNNRTG 3 cut(s) 489, 1038, 1449
SalI GTCGAC 2 cut(s) 121, 923
SaqAI TTAA 6 cut(s) 444, 672, 738, 810, 1002, 1226
SatI GCNGC 5 cut(s) 137, 543, 726, 1245, 1605
Sau3AI GATC 3 cut(s) 836, 868, 1528
Sau96I GGNCC 2 cut(s) 326, 1568
SchI GAGTC 2 cut(s) 102, 171
ScrFI CCNGG 7 cut(s) 213, 312, 330, 661, 846, 1218, 1566
SexAI ACCWGGT 2 cut(s) 844, 1216
SfaNI GCATC 2 cut(s) 1156, 1605
SfcI CTRYAG 1 cut(s) 1605
Sfr274I CTCGAG 1 cut(s) 39
SfuI TTCGAA 1 cut(s) 423
SgrDI CGTCGACG 1 cut(s) 121
SinI GGWCC 2 cut(s) 326, 1568
SlaI CTCGAG 1 cut(s) 39
SmiMI CAYNNNNRTG 3 cut(s) 489, 1038, 1449
SmlI CTYRAG 1 cut(s) 39
SmoI CTYRAG 1 cut(s) 39
SphI GCATGC 1 cut(s) 456
SsiI CCGC 3 cut(s) 236, 1232, 1578
SspI AATATT 1 cut(s) 734
SspMI CTAG 2 cut(s) 626, 900
StyD4I CCNGG 7 cut(s) 211, 310, 328, 659, 844, 1216, 1564
TaaI ACNGT 7 cut(s) 267, 400, 513, 823, 1375, 1552, 1601
TaiI ACGT 2 cut(s) 646, 1398
TaqI TCGA 5 cut(s) 40, 92, 122, 423, 924
TatI WGTACW 3 cut(s) 225, 508, 946
TfiI GAWTC 5 cut(s) 5, 698, 804, 979, 1628
Tru1I TTAA 6 cut(s) 444, 672, 738, 810, 1002, 1226
Tru9I TTAA 6 cut(s) 444, 672, 738, 810, 1002, 1226
TscAI CASTG 1 cut(s) 826
TseFI GTSAC 1 cut(s) 1009
TseI GCWGC 5 cut(s) 136, 542, 725, 1244, 1604
Tsp45I GTSAC 1 cut(s) 1009
TspDTI ATGAA 9 cut(s) 178, 187, 362, 668, 796, 1083, 1339, 1466, 1620
TspRI CASTG 1 cut(s) 826
VpaK11BI GGWCC 2 cut(s) 326, 1568
VspI ATTAAT 2 cut(s) 444, 810
XagI CCTNNNNNAGG 1 cut(s) 315
XapI RAATTY 2 cut(s) 52, 419
XceI RCATGY 2 cut(s) 456, 1502
XhoI CTCGAG 1 cut(s) 39
XmiI GTMKAC 2 cut(s) 122, 924
XmnI GAANNNNTTC 2 cut(s) 23, 56
XspI CTAG 2 cut(s) 626, 900
Zsp2I ATGCAT 1 cut(s) 1456
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.