Rmu_sc0007173.1_g000021

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007173.1
Physical Location & Seq
Reverse (-)
85708 .. 86148
441 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007173.1_g000021.1.cds

Sequence Viewer

Length: 441 bp
atggaggtcaatgggaaatctgtggtagcagcacctgctaatgttatttttctgtcgacaattttgggacgggatgggtcaatgtctgttcataagtgtgactggaagtgtcagaatgagcatgtctgtgggaatatgtatcgctgcaaggtgactggactcactcacatctgtgacaagaattgcaaccagaggattctgtatgataaccatagctctctttgccgggcaagcgggaaggttttcccccttacaccagtagaggaacaggcagtgagaggggtccggaggaagctcgagtcagaggcccctgctgctgcagacaattgttcctttaagcgcagacgggatgcacagctccatccttctcctttcgagagatccttcactactgccagtctgatctgcagcaaagttggagatggcatggacctgagctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

146

Amino Acids

16.12

Weight (kDa)

8.78

Isoelectric Point (pI)

51.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 43
Acc36I ACCTGC 1 cut(s) 43
AccI GTMKAC 1 cut(s) 56
AccIII TCCGGA 1 cut(s) 285
AciI CCGC 1 cut(s) 234
AclWI GGATC 1 cut(s) 375
AleI CACNNNNGTG 1 cut(s) 171
AluBI AGCT 4 cut(s) 216, 295, 358, 438
AluI AGCT 4 cut(s) 216, 295, 358, 438
AlwI GGATC 1 cut(s) 375
AlwNI CAGNNNCTG 1 cut(s) 35
Ama87I CYCGRG 1 cut(s) 296
Aor13HI TCCGGA 1 cut(s) 285
AoxI GGCC 1 cut(s) 306
ApeKI GCWGC 5 cut(s) 29, 144, 314, 317, 408
Asp700I GAANNNNTTC 1 cut(s) 242
AspLEI GCGC 1 cut(s) 342
AspS9I GGNCC 3 cut(s) 283, 307, 430
AsuC2I CCSGG 1 cut(s) 227
AsuHPI GGTGA 1 cut(s) 163
AvaI CYCGRG 1 cut(s) 296
AvaII GGWCC 2 cut(s) 283, 430
BbvI GCAGC 5 cut(s) 41, 131, 301, 304, 420
BccI CCATC 3 cut(s) 68, 369, 416
BcnI CCSGG 1 cut(s) 227
BfaI CTAG 1 cut(s) 439
BfmI CTRYAG 2 cut(s) 318, 406
BfuAI ACCTGC 1 cut(s) 43
BisI GCNGC 5 cut(s) 30, 145, 315, 318, 409
BlsI GCNGC 5 cut(s) 31, 146, 316, 319, 410
Bme1390I CCNGG 1 cut(s) 227
Bme18I GGWCC 2 cut(s) 283, 430
BmeT110I CYCGRG 1 cut(s) 296
BmgT120I GGNCC 3 cut(s) 283, 307, 430
BmiI GGNNCC 2 cut(s) 284, 309
BmrFI CCNGG 1 cut(s) 227
BmsI GCATC 1 cut(s) 340
Bpu10I CCTNAGC 1 cut(s) 434
BpuMI CCSGG 1 cut(s) 227
BsaWI WCCGGW 1 cut(s) 285
Bse1I ACTGG 4 cut(s) 107, 160, 257, 396
BseAI TCCGGA 1 cut(s) 285
BseGI GGATG 3 cut(s) 79, 355, 361
BseMII CTCAG 1 cut(s) 425
BseNI ACTGG 4 cut(s) 107, 160, 257, 396
BseXI GCAGC 5 cut(s) 41, 131, 301, 304, 420
BshFI GGCC 1 cut(s) 308
BsiHKCI CYCGRG 1 cut(s) 296
BsiSI CCGG 2 cut(s) 226, 286
BslFI GGGAC 1 cut(s) 81
BsmFI GGGAC 1 cut(s) 81
BsnI GGCC 1 cut(s) 308
BsoBI CYCGRG 1 cut(s) 296
Bsp13I TCCGGA 1 cut(s) 285
Bsp143I GATC 2 cut(s) 380, 402
BspACI CCGC 1 cut(s) 234
BspANI GGCC 1 cut(s) 308
BspCNI CTCAG 1 cut(s) 426
BspEI TCCGGA 1 cut(s) 285
BspLI GGNNCC 2 cut(s) 284, 309
BspMAI CTGCAG 2 cut(s) 322, 410
BspMI ACCTGC 1 cut(s) 43
BspPI GGATC 1 cut(s) 375
BsrI ACTGG 4 cut(s) 107, 160, 257, 396
BssMI GATC 2 cut(s) 380, 402
BstAPI GCANNNNNTGC 1 cut(s) 35
BstC8I GCNNGC 1 cut(s) 232
BstDEI CTNAG 1 cut(s) 434
BstF5I GGATG 3 cut(s) 79, 355, 361
BstHHI GCGC 1 cut(s) 342
BstKTI GATC 2 cut(s) 383, 405
BstMBI GATC 2 cut(s) 380, 402
BstMWI GCNNNNNNNGC 4 cut(s) 35, 222, 231, 314
BstNSI RCATGY 1 cut(s) 125
BstSCI CCNGG 1 cut(s) 225
BstSFI CTRYAG 2 cut(s) 318, 406
BstV1I GCAGC 5 cut(s) 41, 131, 301, 304, 420
BstX2I RGATCY 1 cut(s) 380
BstYI RGATCY 1 cut(s) 380
BsuRI GGCC 1 cut(s) 308
BtsCI GGATG 3 cut(s) 79, 355, 361
BtsI GCAGTG 1 cut(s) 279
BtsIMutI CAGTG 1 cut(s) 279
BveI ACCTGC 1 cut(s) 43
Cac8I GCNNGC 1 cut(s) 232
CaiI CAGNNNCTG 1 cut(s) 35
CfoI GCGC 1 cut(s) 342
Cfr13I GGNCC 3 cut(s) 283, 307, 430
CviAII CATG 2 cut(s) 122, 427
CviJI RGCY 5 cut(s) 216, 295, 308, 358, 438
CviKI_1 RGCY 5 cut(s) 216, 295, 308, 358, 438
DdeI CTNAG 1 cut(s) 434
DpnI GATC 2 cut(s) 382, 404
DpnII GATC 2 cut(s) 380, 402
Eco47I GGWCC 2 cut(s) 283, 430
Eco88I CYCGRG 1 cut(s) 296
EcoO109I RGGNCCY 1 cut(s) 307
FaeI CATG 2 cut(s) 125, 430
FaiI YATR 6 cut(s) 93, 123, 137, 204, 213, 428
FaqI GGGAC 1 cut(s) 81
FatI CATG 2 cut(s) 121, 426
FauI CCCGC 1 cut(s) 227
FblI GTMKAC 1 cut(s) 56
Fnu4HI GCNGC 5 cut(s) 30, 145, 315, 318, 409
FokI GGATG 3 cut(s) 86, 348, 362
Fsp4HI GCNGC 5 cut(s) 30, 145, 315, 318, 409
FspBI CTAG 1 cut(s) 439
GlaI GCGC 1 cut(s) 341
GluI GCNGC 5 cut(s) 30, 145, 315, 318, 409
HaeIII GGCC 1 cut(s) 308
HapII CCGG 2 cut(s) 226, 286
HhaI GCGC 1 cut(s) 342
Hin1II CATG 2 cut(s) 125, 430
Hin6I GCGC 1 cut(s) 340
HinP1I GCGC 1 cut(s) 340
HincII GTYRAC 1 cut(s) 57
HindII GTYRAC 1 cut(s) 57
HinfI GANTC 3 cut(s) 159, 196, 299
HpaII CCGG 2 cut(s) 226, 286
HphI GGTGA 1 cut(s) 163
Hpy166II GTNNAC 1 cut(s) 57
Hpy188I TCNGA 3 cut(s) 114, 304, 402
Hpy188III TCNNGA 2 cut(s) 286, 376
Hpy8I GTNNAC 1 cut(s) 57
HpyAV CCTTC 3 cut(s) 232, 375, 394
HpyCH4V TGCA 5 cut(s) 147, 186, 320, 353, 408
HpyF10VI GCNNNNNNNGC 4 cut(s) 35, 222, 231, 314
HpyF3I CTNAG 1 cut(s) 434
Hsp92II CATG 2 cut(s) 125, 430
HspAI GCGC 1 cut(s) 340
Kpn2I TCCGGA 1 cut(s) 285
Kzo9I GATC 2 cut(s) 380, 402
LmnI GCTCC 1 cut(s) 363
Lsp1109I GCAGC 5 cut(s) 41, 131, 301, 304, 420
LweI GCATC 1 cut(s) 340
MaeI CTAG 1 cut(s) 439
MaeIII GTNAC 3 cut(s) 98, 151, 173
MalI GATC 2 cut(s) 382, 404
MboI GATC 2 cut(s) 380, 402
MfeI CAATTG 1 cut(s) 325
MflI RGATCY 1 cut(s) 380
MluCI AATT 3 cut(s) 60, 181, 325
MlyI GAGTC 2 cut(s) 153, 308
MmeI TCCRAC 1 cut(s) 397
MnlI CCTC 5 cut(s) 186, 256, 272, 282, 298
MroI TCCGGA 1 cut(s) 285
MroXI GAANNNNTTC 1 cut(s) 242
MseI TTAA 1 cut(s) 336
MslI CAYNNNNRTG 3 cut(s) 96, 126, 171
MspI CCGG 2 cut(s) 226, 286
MspR9I CCNGG 1 cut(s) 227
MunI CAATTG 1 cut(s) 325
MwoI GCNNNNNNNGC 4 cut(s) 35, 222, 231, 314
NciI CCSGG 1 cut(s) 227
NdeII GATC 2 cut(s) 380, 402
NlaIII CATG 2 cut(s) 125, 430
NlaIV GGNNCC 2 cut(s) 284, 309
NmuCI GTSAC 3 cut(s) 98, 151, 173
NspI RCATGY 1 cut(s) 125
OliI CACNNNNGTG 1 cut(s) 171
PaeR7I CTCGAG 1 cut(s) 296
PaqCI CACCTGC 1 cut(s) 43
PdmI GAANNNNTTC 1 cut(s) 242
PfeI GAWTC 1 cut(s) 196
PkrI GCNGC 5 cut(s) 31, 146, 316, 319, 410
PleI GAGTC 2 cut(s) 153, 307
PpsI GAGTC 2 cut(s) 153, 307
PspN4I GGNNCC 2 cut(s) 284, 309
PspPI GGNCC 3 cut(s) 283, 307, 430
PspXI VCTCGAGB 1 cut(s) 296
PstI CTGCAG 2 cut(s) 322, 410
PstNI CAGNNNCTG 1 cut(s) 35
PsuI RGATCY 1 cut(s) 380
RseI CAYNNNNRTG 3 cut(s) 96, 126, 171
SalI GTCGAC 1 cut(s) 55
SaqAI TTAA 1 cut(s) 336
SatI GCNGC 5 cut(s) 30, 145, 315, 318, 409
Sau3AI GATC 2 cut(s) 380, 402
Sau96I GGNCC 3 cut(s) 283, 307, 430
SchI GAGTC 2 cut(s) 153, 308
ScrFI CCNGG 1 cut(s) 227
SetI ASST 9 cut(s) 9, 37, 153, 218, 243, 297, 360, 435, 440
SfaNI GCATC 1 cut(s) 340
SfcI CTRYAG 2 cut(s) 318, 406
Sfr274I CTCGAG 1 cut(s) 296
SinI GGWCC 2 cut(s) 283, 430
SlaI CTCGAG 1 cut(s) 296
SmiMI CAYNNNNRTG 3 cut(s) 96, 126, 171
SmlI CTYRAG 1 cut(s) 296
SmoI CTYRAG 1 cut(s) 296
Sse9I AATT 3 cut(s) 60, 181, 325
SsiI CCGC 1 cut(s) 234
SspMI CTAG 1 cut(s) 439
StyD4I CCNGG 1 cut(s) 225
TaqI TCGA 3 cut(s) 56, 297, 375
TasI AATT 3 cut(s) 60, 181, 325
TfiI GAWTC 1 cut(s) 196
Tru1I TTAA 1 cut(s) 336
Tru9I TTAA 1 cut(s) 336
TscAI CASTG 1 cut(s) 279
TseFI GTSAC 3 cut(s) 98, 151, 173
TseI GCWGC 5 cut(s) 29, 144, 314, 317, 408
Tsp45I GTSAC 3 cut(s) 98, 151, 173
TspDTI ATGAA 1 cut(s) 80
TspRI CASTG 1 cut(s) 279
VpaK11BI GGWCC 2 cut(s) 283, 430
XceI RCATGY 1 cut(s) 125
XhoI CTCGAG 1 cut(s) 296
XmiI GTMKAC 1 cut(s) 56
XmnI GAANNNNTTC 1 cut(s) 242
XspI CTAG 1 cut(s) 439
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.