Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0008322.1

Orthogroup ID

OG0011506

Physical Location & Seq

Genomic Coordinates Reverse (-)

122911 .. 124860

Gene Structure 1950 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0008322.1_g000021.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 669 bp

atgggggccgagagcacctccagtgggattgatcggaacgacaagagctacgagactccggtggtcttgaatgtctacgacctcacccctatcaacaattattctgtttggttcggtatcggaatattccactccggtattgaagttcatggtaaggagtatggttttggagcccatgacttcccagttagtggagtttttgaagtggaaccaaaggcctgccccggtttcatttaccgatgctctatttcacttggtcgcataaacatgcctccttctgaatttcggacatttattgagaatgttgctgcggagtatcatggggatacatatcacctcatctccaagaattgcaaccattttaccgatgacatagcatgtcggttgacagaaaaacggattcctggatgggtgaaccggcttgctcggctaggttccttgtgtagctgtcttcttccagaaagccttcaagtgactactgttaagcagactcctgaataccatcatgagtcagaagaagatggtactgaatctctaacaatcaccacgcctcgtgagtcgacagaagttgatgacgatcaagaaaagcgtctgctgtcaccattggctgcagcgtcaccgatgtctggatgcggggatgtgacttttgttaaagagactcacaagtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Peptidase_C97

Protein Analysis

222

Amino Acids

24.67

Weight (kDa)

5.07

Isoelectric Point (pI)

49.11

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011506)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g03840 FvH4_1g03840 FvH4_1g03840
malus_domestica	MD02G1036800.v1.1 MD15G1176900.v1.1
prunus_persica	Prupe.7G238600_v2.0.a1 Prupe.7G238600_v2.0.a1 Prupe.7G238600_v2.0.a1 Prupe.7G238600_v2.0.a1
pyrus_communis	pycom15g15840
rosa_chinensis	RchiOBHm_Chr2g0089231
rosa_laevigata	RLG00000016007
rosa_multiflora	Rmu_sc0008322.1_g000021 Rmu_sc0027405.1_g000001
rosa_roxburghii	Rroxscaffold_2G00152120
rosa_rugosa	Rorug01G0488600 Rorug01G0488600
rosa_samantha	Rh2AG044400 Rh2DG043300
rosa_wichuraiana	Rw2G003880

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	191
AccI	GTMKAC	2 cut(s)	75, 560
AciI	CCGC	2 cut(s)	311, 633
AcsI	RAATTY	1 cut(s)	281
AfaI	GTAC	1 cut(s)	526
AfiI	CCNNNNNNNGG	3 cut(s)	24, 191, 626
AgsI	TTSAA	4 cut(s)	70, 143, 203, 470
AjnI	CCWGG	1 cut(s)	403
AluBI	AGCT	2 cut(s)	48, 447
AluI	AGCT	2 cut(s)	48, 447
Alw21I	GWGCWC	1 cut(s)	17
Alw26I	GTCTC	2 cut(s)	47, 650
AoxI	GGCC	2 cut(s)	6, 216
ApeKI	GCWGC	3 cut(s)	308, 608, 611
ApoI	RAATTY	1 cut(s)	281
Asp700I	GAANNNNTTC	1 cut(s)	465
AspS9I	GGNCC	1 cut(s)	6
AsuC2I	CCSGG	1 cut(s)	225
AsuHPI	GGTGA	6 cut(s)	76, 326, 424, 535, 591, 609
BanII	GRGCYC	1 cut(s)	175
BauI	CACGAG	1 cut(s)	552
BbsI	GAAGAC	1 cut(s)	443
Bbv12I	GWGCWC	1 cut(s)	17
BbvI	GCAGC	3 cut(s)	295, 595, 623
BccI	CCATC	3 cut(s)	402, 510, 515
BciT130I	CCWGG	1 cut(s)	405
BciVI	GTATCC	1 cut(s)	319
BcnI	CCSGG	1 cut(s)	225
BcoDI	GTCTC	2 cut(s)	47, 650
BfaI	CTAG	1 cut(s)	431
BfmI	CTRYAG	1 cut(s)	609
BfuI	GTATCC	1 cut(s)	319
BisI	GCNGC	3 cut(s)	309, 609, 612
BlsI	GCNGC	3 cut(s)	310, 610, 613
Bme1390I	CCNGG	2 cut(s)	225, 405
BmgT120I	GGNCC	1 cut(s)	6
BmiI	GGNNCC	4 cut(s)	7, 172, 210, 436
BmrFI	CCNGG	2 cut(s)	225, 405
BmrI	ACTGGG	1 cut(s)	179
BmsI	GCATC	2 cut(s)	230, 620
BmuI	ACTGGG	1 cut(s)	179
BpiI	GAAGAC	1 cut(s)	443
BplI	GAGNNNNNCTC	1 cut(s)	34
BpmI	CTGGAG	1 cut(s)	4
BpuMI	CCSGG	1 cut(s)	225
BsaBI	GATNNNNATC	2 cut(s)	330, 576
BsaJI	CCNNGG	1 cut(s)	223
BsaWI	WCCGGW	2 cut(s)	58, 134
BsaXI	ACNNNNNCTCC	2 cut(s)	326, 356
Bsc4I	CCNNNNNNNGG	3 cut(s)	24, 191, 626
Bse118I	RCCGGY	1 cut(s)	417
Bse1I	ACTGG	2 cut(s)	21, 185
Bse8I	GATNNNNATC	2 cut(s)	330, 576
BseBI	CCWGG	1 cut(s)	405
BseDI	CCNNGG	1 cut(s)	223
BseGI	GGATG	3 cut(s)	413, 635, 643
BseJI	GATNNNNATC	2 cut(s)	330, 576
BseLI	CCNNNNNNNGG	3 cut(s)	24, 191, 626
BseNI	ACTGG	2 cut(s)	21, 185
BseXI	GCAGC	3 cut(s)	295, 595, 623
BshFI	GGCC	2 cut(s)	8, 218
BsiHKAI	GWGCWC	1 cut(s)	17
BsiSI	CCGG	4 cut(s)	59, 135, 225, 418
BslI	CCNNNNNNNGG	3 cut(s)	24, 191, 626
BsmAI	GTCTC	2 cut(s)	47, 650
BsnI	GGCC	2 cut(s)	8, 218
Bsp1286I	GDGCHC	2 cut(s)	17, 175
Bsp143I	GATC	2 cut(s)	31, 577
BspACI	CCGC	2 cut(s)	311, 633
BspANI	GGCC	2 cut(s)	8, 218
BspHI	TCATGA	1 cut(s)	505
BspLI	GGNNCC	4 cut(s)	7, 172, 210, 436
BspMAI	CTGCAG	1 cut(s)	613
BsrFI	RCCGGY	1 cut(s)	417
BsrI	ACTGG	2 cut(s)	21, 185
BssAI	RCCGGY	1 cut(s)	417
BssECI	CCNNGG	1 cut(s)	223
BssMI	GATC	2 cut(s)	31, 577
BssSI	CACGAG	1 cut(s)	552
Bst2BI	CACGAG	1 cut(s)	552
Bst2UI	CCWGG	1 cut(s)	405
Bst4CI	ACNGT	1 cut(s)	481
BstC8I	GCNNGC	2 cut(s)	220, 423
BstF5I	GGATG	3 cut(s)	413, 635, 643
BstKTI	GATC	2 cut(s)	34, 580
BstMAI	GTCTC	2 cut(s)	47, 650
BstMBI	GATC	2 cut(s)	31, 577
BstMWI	GCNNNNNNNGC	1 cut(s)	427
BstNI	CCWGG	1 cut(s)	405
BstNSI	RCATGY	2 cut(s)	271, 381
BstSCI	CCNGG	2 cut(s)	223, 403
BstSFI	CTRYAG	1 cut(s)	609
BstV1I	GCAGC	3 cut(s)	295, 595, 623
BstV2I	GAAGAC	1 cut(s)	443
BsuI	GTATCC	1 cut(s)	319
BsuRI	GGCC	2 cut(s)	8, 218
BtsCI	GGATG	3 cut(s)	413, 635, 643
BtsIMutI	CAGTG	1 cut(s)	28
Cac8I	GCNNGC	2 cut(s)	220, 423
CciI	TCATGA	1 cut(s)	505
Cfr10I	RCCGGY	1 cut(s)	417
Cfr13I	GGNCC	1 cut(s)	6
CseI	GACGC	2 cut(s)	578, 603
Csp6I	GTAC	1 cut(s)	525
CviAII	CATG	6 cut(s)	149, 176, 268, 320, 378, 506
CviJI	RGCY	9 cut(s)	8, 48, 173, 218, 421, 430, 447, 465, 608
CviKI_1	RGCY	9 cut(s)	8, 48, 173, 218, 421, 430, 447, 465, 608
CviQI	GTAC	1 cut(s)	525
DpnI	GATC	2 cut(s)	33, 579
DpnII	GATC	2 cut(s)	31, 577
Eco147I	AGGCCT	1 cut(s)	218
Eco24I	GRGCYC	1 cut(s)	175
EcoRII	CCWGG	1 cut(s)	403
EcoT38I	GRGCYC	1 cut(s)	175
FaeI	CATG	6 cut(s)	152, 179, 271, 323, 381, 509
FatI	CATG	6 cut(s)	148, 175, 267, 319, 377, 505
FauI	CCCGC	1 cut(s)	626
FblI	GTMKAC	2 cut(s)	75, 560
Fnu4HI	GCNGC	3 cut(s)	309, 609, 612
FokI	GGATG	3 cut(s)	420, 642, 650
FriOI	GRGCYC	1 cut(s)	175
Fsp4HI	GCNGC	3 cut(s)	309, 609, 612
FspBI	CTAG	1 cut(s)	431
GluI	GCNGC	3 cut(s)	309, 609, 612
GsuI	CTGGAG	1 cut(s)	4
HaeIII	GGCC	2 cut(s)	8, 218
HapII	CCGG	4 cut(s)	59, 135, 225, 418
HgaI	GACGC	2 cut(s)	578, 603
Hin1II	CATG	6 cut(s)	152, 179, 271, 323, 381, 509
HincII	GTYRAC	2 cut(s)	387, 561
HindII	GTYRAC	2 cut(s)	387, 561
HinfI	GANTC	7 cut(s)	55, 400, 490, 509, 530, 557, 658
HpaII	CCGG	4 cut(s)	59, 135, 225, 418
HphI	GGTGA	6 cut(s)	76, 326, 424, 535, 591, 609
Hpy166II	GTNNAC	4 cut(s)	76, 387, 415, 561
Hpy188I	TCNGA	5 cut(s)	36, 122, 280, 288, 514
Hpy188III	TCNNGA	7 cut(s)	67, 458, 494, 506, 554, 581, 627
Hpy8I	GTNNAC	4 cut(s)	76, 387, 415, 561
HpyAV	CCTTC	2 cut(s)	285, 476
HpyCH4III	ACNGT	1 cut(s)	481
HpyCH4V	TGCA	2 cut(s)	354, 611
HpyF10VI	GCNNNNNNNGC	1 cut(s)	427
Hsp92II	CATG	6 cut(s)	152, 179, 271, 323, 381, 509
Kzo9I	GATC	2 cut(s)	31, 577
LmnI	GCTCC	1 cut(s)	170
Lsp1109I	GCAGC	3 cut(s)	295, 595, 623
LweI	GCATC	2 cut(s)	230, 620
MaeI	CTAG	1 cut(s)	431
MaeIII	GTNAC	4 cut(s)	472, 597, 615, 640
MalI	GATC	2 cut(s)	33, 579
MboI	GATC	2 cut(s)	31, 577
MboII	GAAGA	4 cut(s)	443, 446, 527, 530
MhlI	GDGCHC	2 cut(s)	17, 175
MluCI	AATT	3 cut(s)	97, 281, 349
MlyI	GAGTC	5 cut(s)	49, 484, 518, 566, 652
MnlI	CCTC	5 cut(s)	28, 92, 282, 347, 561
MroXI	GAANNNNTTC	1 cut(s)	465
MseI	TTAA	2 cut(s)	483, 651
MslI	CAYNNNNRTG	1 cut(s)	266
MspI	CCGG	4 cut(s)	59, 135, 225, 418
MspR9I	CCNGG	2 cut(s)	225, 405
MvaI	CCWGG	1 cut(s)	405
MwoI	GCNNNNNNNGC	1 cut(s)	427
NciI	CCSGG	1 cut(s)	225
NdeII	GATC	2 cut(s)	31, 577
NlaIII	CATG	6 cut(s)	152, 179, 271, 323, 381, 509
NlaIV	GGNNCC	4 cut(s)	7, 172, 210, 436
NmeAIII	GCCGAG	2 cut(s)	34, 406
NmuCI	GTSAC	4 cut(s)	472, 597, 615, 640
NspI	RCATGY	2 cut(s)	271, 381
PagI	TCATGA	1 cut(s)	505
PceI	AGGCCT	1 cut(s)	218
PdmI	GAANNNNTTC	1 cut(s)	465
PfeI	GAWTC	2 cut(s)	400, 530
PflMI	CCANNNNNTGG	1 cut(s)	191
PfoI	TCCNGGA	1 cut(s)	403
PkrI	GCNGC	3 cut(s)	310, 610, 613
PleI	GAGTC	5 cut(s)	49, 484, 517, 565, 652
PpsI	GAGTC	5 cut(s)	49, 484, 517, 565, 652
Psp6I	CCWGG	1 cut(s)	403
PspGI	CCWGG	1 cut(s)	403
PspN4I	GGNNCC	4 cut(s)	7, 172, 210, 436
PspPI	GGNCC	1 cut(s)	6
PstI	CTGCAG	1 cut(s)	613
RsaI	GTAC	1 cut(s)	526
RsaNI	GTAC	1 cut(s)	525
RseI	CAYNNNNRTG	1 cut(s)	266
SalI	GTCGAC	1 cut(s)	559
SaqAI	TTAA	2 cut(s)	483, 651
SatI	GCNGC	3 cut(s)	309, 609, 612
Sau3AI	GATC	2 cut(s)	31, 577
Sau96I	GGNCC	1 cut(s)	6
SchI	GAGTC	5 cut(s)	49, 484, 518, 566, 652
ScrFI	CCNGG	2 cut(s)	225, 405
SduI	GDGCHC	2 cut(s)	17, 175
SetI	ASST	6 cut(s)	20, 50, 84, 339, 436, 449
SfaNI	GCATC	2 cut(s)	230, 620
SfcI	CTRYAG	1 cut(s)	609
SmiMI	CAYNNNNRTG	1 cut(s)	266
Sse9I	AATT	3 cut(s)	97, 281, 349
SseBI	AGGCCT	1 cut(s)	218
SsiI	CCGC	2 cut(s)	311, 633
SspI	AATATT	1 cut(s)	126
SspMI	CTAG	1 cut(s)	431
StuI	AGGCCT	1 cut(s)	218
StyD4I	CCNGG	2 cut(s)	223, 403
TaaI	ACNGT	1 cut(s)	481
TaqI	TCGA	1 cut(s)	560
TasI	AATT	3 cut(s)	97, 281, 349
TfiI	GAWTC	2 cut(s)	400, 530
Tru1I	TTAA	2 cut(s)	483, 651
Tru9I	TTAA	2 cut(s)	483, 651
TscAI	CASTG	1 cut(s)	28
TseFI	GTSAC	4 cut(s)	472, 597, 615, 640
TseI	GCWGC	3 cut(s)	308, 608, 611
Tsp45I	GTSAC	4 cut(s)	472, 597, 615, 640
TspDTI	ATGAA	2 cut(s)	137, 220
TspGWI	ACGGA	1 cut(s)	412
TspRI	CASTG	1 cut(s)	28
Van91I	CCANNNNNTGG	1 cut(s)	191
XapI	RAATTY	1 cut(s)	281
XceI	RCATGY	2 cut(s)	271, 381
XmiI	GTMKAC	2 cut(s)	75, 560
XmnI	GAANNNNTTC	1 cut(s)	465
XspI	CTAG	1 cut(s)	431

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.